View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662_low_13 (Length: 336)
Name: NF0662_low_13
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0662_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 7353154 - 7353363
Alignment:
Q |
8 |
cgaagaatatggtagaaaaatcaaacaatacatgtttcttgacgtcaatgagtgtagaaatcttttagcagnnnnnnnncaatgatttcagactagtctt |
107 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7353154 |
cgaaaaatatggtagaaaaatcaaacaatacatgtttcttgacgtcaatgagtgtagaaatcttttagcagtcttttttcaatgatttcagactagtctt |
7353253 |
T |
 |
Q |
108 |
tctagcggtcgttcggggtattttgannnnnnn--ggctgccggagagtaatatcggaagcctaaagaatagttttcttgtcatgaaagcttggtctaca |
205 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7353254 |
tctagcggtcgttcggggtattttgatttttttttggctgccggagagtaatatcggaagcctaaagaatagttttcttgtcatgaaagcttggtctaca |
7353353 |
T |
 |
Q |
206 |
tgaacaactc |
215 |
Q |
|
|
||||| |||| |
|
|
T |
7353354 |
tgaacgactc |
7353363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University