View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662_low_16 (Length: 301)
Name: NF0662_low_16
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0662_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 292
Target Start/End: Complemental strand, 35696188 - 35695894
Alignment:
Q |
7 |
aaatgattctttctttctctctaaggggataaacaacatgatttggttatgatggaaagctaaaaatggcatgnnnnnnnnnnnnnnnngggtttgattc |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
35696188 |
aaatgattctttctttctctctaaggggataaacaacatgatttggttatgatggaaagctaaaaatggcat--ttttattttatttttgggtttgattc |
35696091 |
T |
 |
Q |
107 |
atgcatggaaagattggatgaaggagagaatagtggttgttgagataaattggttttggtatctgtcatggacaatttcttatgattt-----------t |
195 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
35696090 |
atgcatgaaaagattggatgaaggagagaatagtggttgttgagataaattggttttggtatctgtcatggacaatttcttatgatttcattgatttttt |
35695991 |
T |
 |
Q |
196 |
actcaactagttaggaaccttctaccaaaaataggatagaaaatggatcacaaccgtgttgtttgcatttcaaccggttaatttcggccattcatct |
292 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35695990 |
actcaactagttaagaaccttctaccaaaaataggatagaaaatggatcacaaccgtgttgtttgcatttcaaccggttaatttcggccattcatct |
35695894 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University