View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662_low_18 (Length: 263)
Name: NF0662_low_18
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0662_low_18 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 63 - 263
Target Start/End: Complemental strand, 15181073 - 15180873
Alignment:
| Q |
63 |
tgttcgacaaagaaagaaacaacaccatgaactggtttctcactttcaacaactacaacattatttgacacattactcactgaatttgcaacaaactttg |
162 |
Q |
| |
|
||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15181073 |
tgttcaacaaagtaggaaacaacaccatgaactggtttctcactttcaacaactacaacattatttgacacattactcactgaatgtgcaacaaactttg |
15180974 |
T |
|
| Q |
163 |
gtccctctaatgtatgaaatgaatactgaaaatgactaatcctattaggaaacaccaaaacatttgaaaaatcacccacccattttgtgccattaccatc |
262 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15180973 |
gtccttctaatgtatgaaatgaatactgaaaatgactaatcctattaggaaacaccaaaacatttgaaaaatcacccacccattttgtgccattaccatc |
15180874 |
T |
|
| Q |
263 |
c |
263 |
Q |
| |
|
| |
|
|
| T |
15180873 |
c |
15180873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 260
Target Start/End: Original strand, 38858856 - 38859017
Alignment:
| Q |
99 |
ttctcactttcaacaactacaacattatttgacacattactcactgaatttgcaacaaactttggtccctctaatgtatgaaatgaatactgaaaatgac |
198 |
Q |
| |
|
|||||||| || |||||||||||||||| ||| ||||| |||| |||| ||| ||||| ||||| || || | || ||||||||| |||| ||||| |
|
|
| T |
38858856 |
ttctcactctccacaactacaacattatctgatacattggtcacagaatgtgctacaaattttggctccccttgagcataaaatgaatattgaacatgac |
38858955 |
T |
|
| Q |
199 |
taatcctattaggaaacaccaaaacatttgaaaaatcacccacccattttgtgccattacca |
260 |
Q |
| |
|
|||||| ||||||||| |||||||| |||||||||| || |||| ||||||||||||||| |
|
|
| T |
38858956 |
taatccgattaggaaataccaaaactgatgaaaaatcagcctcccactttgtgccattacca |
38859017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1226 times since January 2019
Visitors: 4114