View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662_low_22 (Length: 250)
Name: NF0662_low_22
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0662_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 38950060 - 38949902
Alignment:
Q |
1 |
cagccgccacctatcaaaacagccaaccacactatc------tccagcagaaaaagaaaactgtagcaggccattccatataaaaacagcagaaccggac |
94 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
38950060 |
cagctgccacctatcaaaacagccaaccacactaagatggcatccagcagaaaaagaaaaccgtagcaggccattccatatcaaaacagcagcaccggac |
38949961 |
T |
 |
Q |
95 |
ctcattgttaccgcaataagcaatcttttggttttgggttccaacactggaagatgaac |
153 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
38949960 |
ctcattgttaccgcaataagcaatcttttggttttgggttccaacaccggaagatgaac |
38949902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 977 times since January 2019
Visitors: 4105