View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662_low_25 (Length: 226)
Name: NF0662_low_25
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0662_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 43905816 - 43906018
Alignment:
Q |
1 |
atctatttgatctattattattggcaaaaataaaatcaatccatatcacacctccgttcttgaattttaacatacttttttggtctataattttttaccc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43905816 |
atctatttgatctattattattggcaaaaataaaatcaatccatatcacacctccgttcttgaattttaacatacttttttggtctataattttttaccc |
43905915 |
T |
 |
Q |
101 |
aatcaatattaattcagatgcaaaaagagaaaagcactaatccaaatttagtgcacaaaattactgtctgtttttatatatttagataattaaccgtcaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43905916 |
aatcaatattaattcagatgcaaaaagagaaaagcactaatccaaatttagtgcacaaaattactgtctgtttttatatatttagataattaaccgtcaa |
43906015 |
T |
 |
Q |
201 |
atc |
203 |
Q |
|
|
||| |
|
|
T |
43906016 |
atc |
43906018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University