View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0663_high_15 (Length: 257)

Name: NF0663_high_15
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0663_high_15
NF0663_high_15
[»] chr8 (2 HSPs)
chr8 (7-191)||(27293085-27293269)
chr8 (192-257)||(27292994-27293059)


Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 27293269 - 27293085
Alignment:
7 aataggccggagaggaggaatgcttttcgacctcatacggttaaggagcttattcgtgctttcaatgatgctagagatgatccctctgttggtgtcatca 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27293269 aataggccggagaggaggaatgcttttcgacctcatacggttaaggagcttattcgtgctttcaatgatgctagagatgatccctctgttggtgtcatca 27293170  T
107 ttctcacgggaaaggtataccttttctgctactgccatttgttttattgttttgtgaacttgggcatgttgaggcaagaaatgga 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||    
27293169 ttctcacgggaaaggtataccttttctgctactgccatttgttttattgttttgtgaacttggtcatgttgaggtaagaaatgga 27293085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 192 - 257
Target Start/End: Complemental strand, 27293059 - 27292994
Alignment:
192 attatcatacaactagttcaccactaatttgttatgtgacttcagcattgctttaagtgattatta 257  Q
    ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
27293059 attatcatacaactagttcactactaatttgttatgtgacttaagcattgctttaagtgattatta 27292994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 824 times since January 2019
Visitors: 4101