View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_high_19 (Length: 251)
Name: NF0663_high_19
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0663_high_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 28 - 251
Target Start/End: Complemental strand, 29368285 - 29368063
Alignment:
| Q |
28 |
gttgcctgactcatcatctaccgatgggtattgggtataacctacatataccgtctagttattataattttaaataataagnnnnnnnnttctttcaaat |
127 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
29368285 |
gttgactgactcatcatctaccgatgggtatcgggtataacctacatataccgtctagttattataattttaaataataagaaaaaaa-tactttcaaat |
29368187 |
T |
|
| Q |
128 |
aaataaattcatttattattaatttaaagatcgattgtatggttgcatgttgaattttctattataatttatagcgcagaaattatctatagtaagaaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29368186 |
aaataaattcatttattattaattttaagatcgattgtatggttgcatgttgaattttctattataatttatagcgcagaaattatctatagtaagaaaa |
29368087 |
T |
|
| Q |
228 |
taacgatggaagtaaggaattgat |
251 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
29368086 |
taacgatggaagtaagtaattgat |
29368063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 813 times since January 2019
Visitors: 4101