View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_low_14 (Length: 408)
Name: NF0663_low_14
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0663_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 30 - 250
Target Start/End: Original strand, 30638055 - 30638274
Alignment:
| Q |
30 |
gttagatgaataatatttacgtaggtcgtttattgtgtcatttgtactattttattaaatgtttagacatcgatataaaatatttataagtaccttgatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30638055 |
gttagatgaataatatttacgtaggtcgtttattgtgtcatttgtactattttattaaatgtttagacatcgatataaaatatttataagtaccttgatc |
30638154 |
T |
|
| Q |
130 |
aatatttttcaatagttaattgattagctaggaagatcaattaatatattaagtatcggtttcatgaattaaattgtatttgcttaagttcttctgattt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
30638155 |
aatatttttcaatagtt-attgattagctaggaagatcaattaatatattaagtattggttttatggattaaattatatttgcttaagttcttctgattt |
30638253 |
T |
|
| Q |
230 |
tttcttatgttaatcgattaa |
250 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30638254 |
tttcttatgttaatcgattaa |
30638274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 716 times since January 2019
Visitors: 4098