View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_low_2 (Length: 578)
Name: NF0663_low_2
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0663_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 420; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 130 - 553
Target Start/End: Original strand, 48669127 - 48669550
Alignment:
| Q |
130 |
tattctgctgttccaactatggctactaacgaaggtgacatgttctcagcagagattgtgaaccgtgggattgaatcatcgggtccgaacgccggttcat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669127 |
tattctgctgttccaactatggctactaacgaaggtgacatgttctcagcagagattgtgaaccgtgggattgaatcatcgggtccgaacgccggttcat |
48669226 |
T |
|
| Q |
230 |
tgacgttctctgttcgtgttcggagacggttaccggattttcttcaatctgtgaaccttaagtatgtgaaattgggttaccattatctgataaaccatgg |
329 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669227 |
tgacgttctctgtccgtgttcggagacggttaccggattttcttcaatctgtgaaccttaagtatgtgaaattgggttaccattatctgataaaccatgg |
48669326 |
T |
|
| Q |
330 |
tgtttatttgttcactataccaattctacttgttgtgtttagtgctgaggttggtagtcttagcaaagaagatctttggaagaagatttgggaagatgca |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669327 |
tgtttatttgttcactataccaattctacttgttgtgtttagtgctgaggttggtagtcttagcaaagaagatctttggaagaagatttgggaagatgca |
48669426 |
T |
|
| Q |
430 |
acttatgatcttgcatctgttctctcttctcttgctgtctttgttttcactttcactctttacttcatgtcaaggccacgtcctatttatctcattgatt |
529 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669427 |
acttatgatcttgcatctgttctctcttctcttgctgtctttgttttcactttcactctttacttcatgtcaaggccacgtcctatttatctcattgatt |
48669526 |
T |
|
| Q |
530 |
ttgcatgctatcaacctgatgatg |
553 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48669527 |
ttgcatgctatcaacctgatgatg |
48669550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 48668998 - 48669045
Alignment:
| Q |
1 |
taactcttttccacccaccttatgtaaaatcaatttcatggatttcat |
48 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48668998 |
taactcttttccacccacctcatgtaaaatcaatttcatggatttcat |
48669045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 531 times since January 2019
Visitors: 4087