View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_low_30 (Length: 257)
Name: NF0663_low_30
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0663_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 27293269 - 27293085
Alignment:
Q |
7 |
aataggccggagaggaggaatgcttttcgacctcatacggttaaggagcttattcgtgctttcaatgatgctagagatgatccctctgttggtgtcatca |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27293269 |
aataggccggagaggaggaatgcttttcgacctcatacggttaaggagcttattcgtgctttcaatgatgctagagatgatccctctgttggtgtcatca |
27293170 |
T |
 |
Q |
107 |
ttctcacgggaaaggtataccttttctgctactgccatttgttttattgttttgtgaacttgggcatgttgaggcaagaaatgga |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
T |
27293169 |
ttctcacgggaaaggtataccttttctgctactgccatttgttttattgttttgtgaacttggtcatgttgaggtaagaaatgga |
27293085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 192 - 257
Target Start/End: Complemental strand, 27293059 - 27292994
Alignment:
Q |
192 |
attatcatacaactagttcaccactaatttgttatgtgacttcagcattgctttaagtgattatta |
257 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
27293059 |
attatcatacaactagttcactactaatttgttatgtgacttaagcattgctttaagtgattatta |
27292994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1015 times since January 2019
Visitors: 4109