View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_low_31 (Length: 256)
Name: NF0663_low_31
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0663_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 42241385 - 42241631
Alignment:
| Q |
1 |
cacttacacatatggttgaaatannnnnnngtcctttatcttttacctaatatttgtt-cggtcttaagattcattttcatcctttatcttttctaaatt |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42241385 |
cacttacacatatggttgaaatattttt--gtcctttatcttttacctaatatttgtttcggtcttaagattcattttcatcctttatcttttctaaatt |
42241482 |
T |
|
| Q |
100 |
gatcattgttaatccttttctcatgataacttaaatatgaaatggaaagaaaaacaaatgctaacttggcaaatgttgtcccgtttaaattgtctttaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42241483 |
gatcattgttaatccttttctcatgaaaacttaaatatgaaatggaaagaaaaacaaatgctaacttggcaaatgttgtcctgtttaaattgtctttaaa |
42241582 |
T |
|
| Q |
200 |
tggtttatagccgtctttatattattctctttacttggtgattttgttg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42241583 |
tggtttatagccgtctttatattattctctttacttggtgattttgttg |
42241631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 606 times since January 2019
Visitors: 4091