View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_low_35 (Length: 251)
Name: NF0663_low_35
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0663_low_35 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 34052528 - 34052773
Alignment:
| Q |
8 |
ccaagaatattgaccc-ttttaggtgtgtgtaaactcatagtacaaattgtcaacatctttacaactaagggaccatgaataaatgattgaaattaacat |
106 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34052528 |
ccaaaaatattgaccccttttaggtgtgtgtaaactcatagtacaaattgtcaacatctttacaactaagggaccatgaataaatgattgaaattaacat |
34052627 |
T |
 |
| Q |
107 |
tcacttatgcattcattcaaacttatgatcttaatataccaaaaataccatgttattatatacaaacaatttgattaacacttttatta-tatgtatagg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34052628 |
tcacttatgcattcattcaaacttatgatcttaatataccaaaaataccatgttattatatacaaacaatttgatcaacacttttattattatgtatagg |
34052727 |
T |
 |
| Q |
206 |
ttcatccaaactcttatgcattagtggtgagcatggagaacatcac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34052728 |
ttcatccaaactcttatgcattagtggtgagcatggagaacatcac |
34052773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 15239023 - 15239071
Alignment:
| Q |
200 |
tataggttcatccaaactcttatgcattagtggtgagcatggagaacat |
248 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
15239023 |
tataggtacatccaaactcatatgccttagtagtgagcatggagaacat |
15239071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 31333432 - 31333480
Alignment:
| Q |
203 |
aggttcatccaaactcttatgcattagtggtgagcatggagaacatcac |
251 |
Q |
| |
|
|||||||||| ||||| |||||||| || || ||||||||||||||||| |
|
|
| T |
31333432 |
aggttcatcctaactcgtatgcattggttgttagcatggagaacatcac |
31333480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University