View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0663_low_41 (Length: 212)
Name: NF0663_low_41
Description: NF0663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0663_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 22 - 191
Target Start/End: Complemental strand, 17075565 - 17075396
Alignment:
| Q |
22 |
tctttgctgggcaaccgcgccaccttcttcaaactaaataccgaatgccgcaaaattccattcactttcttcctctttataactattgaactggatttag |
121 |
Q |
| |
|
|||||||| |||| |||||||||||| |||| ||||| ||||| || ||||||||||| ||||||||||||| ||| |||| || | |||||||| | |
|
|
| T |
17075565 |
tctttgctaggcagccgcgccacctttttcagactaatcaccgagtgtcgcaaaattccgttcactttcttccgcttgttaacgatggtactggattgtg |
17075466 |
T |
|
| Q |
122 |
caaaaggccgcaccactttcttaaccttctttcttgtcgaagaaataacaccagcgactccatgatgatg |
191 |
Q |
| |
|
||| |||||||||||||||||||||||||| |||| ||||||||||||||||||| | |||| |||||| |
|
|
| T |
17075465 |
caatgggccgcaccactttcttaaccttcttccttgccgaagaaataacaccagcgtcaccattatgatg |
17075396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 22 - 191
Target Start/End: Complemental strand, 11053639 - 11053470
Alignment:
| Q |
22 |
tctttgctgggcaaccgcgccaccttcttcaaactaaataccgaatgccgcaaaattccattcactttcttcctctttataactattga-actggattta |
120 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| ||||| ||||||| || |||||||||||||||| || | | | || || ||||| |
|
|
| T |
11053639 |
tctttgctaggcaaccgcgccacctttttcaaactaatcaccgagtgccgcagaaccccattcactttcttccgattgtttgc-acagataccggattgg |
11053541 |
T |
|
| Q |
121 |
gcaaaaggccgcaccactttcttaaccttctttcttgtcgaagaaataacaccagcgactccatgatgatg |
191 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||| | ||||||||||| |
|
|
| T |
11053540 |
gcaataggccgcaccactttcttaaccttctttcttgccgatgaaataacaccagcgtcaccatgatgatg |
11053470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 121 - 192
Target Start/End: Complemental strand, 10558490 - 10558419
Alignment:
| Q |
121 |
gcaaaaggccgcaccactttcttaaccttctttcttgtcgaagaaataacaccagcgactccatgatgatgt |
192 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
10558490 |
gcaataggccgcaccactttcttaaccttctttcttgccgaagaaataacaccagcgtcaccatgatgatgt |
10558419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 10559815 - 10559739
Alignment:
| Q |
22 |
tctttgctgggcaaccgcgccaccttcttcaaactaaataccgaatgccgcaaaattccattcactttcttcctctt |
98 |
Q |
| |
|
|||||||| |||| | || ||||||| |||||||||| ||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
10559815 |
tctttgctaggcagctgccccacctttttcaaactaatcaccgagtgccgcagaaacccattcactttcttcctctt |
10559739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 7 - 191
Target Start/End: Original strand, 17684079 - 17684263
Alignment:
| Q |
7 |
aaaacggcggcccggtctttgctgggcaaccgcgccaccttcttcaaactaaataccgaatgccgcaaaattccattcactttcttcc---tcttt--at |
101 |
Q |
| |
|
||||||| || ||| |||||||| |||||| |||||||||| |||||||||| ||||| |||||||||| |||||||||||||||| | ||| | |
|
|
| T |
17684079 |
aaaacggtggaccgatctttgctaggcaactgcgccacctttttcaaactaatcaccgagtgccgcaaaaccccattcactttcttccgtttgtttgcac |
17684178 |
T |
|
| Q |
102 |
aactattgaactggatttagcaaaaggccgcaccactttcttaaccttctttcttgtcgaagaaataacaccagcgactccatgatgatg |
191 |
Q |
| |
|
|| ||| | | |||| || |||||||||||||||| | ||||||||||||| ||| ||||||||||||||| | ||||||||||| |
|
|
| T |
17684179 |
aaatatcggattgga-----aaataggccgcaccactttcctgaccttctttcttgccgatgaaataacaccagcgtcaccatgatgatg |
17684263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 191
Target Start/End: Original strand, 26741724 - 26741893
Alignment:
| Q |
22 |
tctttgctgggcaaccgcgccaccttcttcaaactaaataccgaatgccgcaaaattccattcactttcttcctctttataactattgaactggatttag |
121 |
Q |
| |
|
||||||| ||||| ||| ||||||| |||||||||| |||| | ||| || || ||||||||||||||| ||| |||| | | || |||| || |
|
|
| T |
26741724 |
tctttgcagggcagccgatccacctttttcaaactaatcaccgggttccgtaagatctcattcactttcttccgcttgttaacaaaggtacatgattgag |
26741823 |
T |
|
| Q |
122 |
caaaaggccgcaccactttcttaaccttctttcttgtcgaagaaataacaccagcgactccatgatgatg |
191 |
Q |
| |
|
||| |||| || ||||| ||||||||||||| || | ||| |||||||||||||| | ||||||||||| |
|
|
| T |
26741824 |
caataggctgcgccactctcttaaccttcttcctagccgatgaaataacaccagcatcaccatgatgatg |
26741893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 500 times since January 2019
Visitors: 4087