View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_high_5 (Length: 324)
Name: NF0664_high_5
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0664_high_5 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 5 - 324
Target Start/End: Complemental strand, 61545 - 61223
Alignment:
| Q |
5 |
tctcgaagaatatggtagaaatgaatgaaattagaaagagaaatgattggtgtgtagagaaagaatgaatgggtgatagataaaacttatactgtccgta |
104 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
61545 |
tctccaagaatttggtagaaatgaatgaaattagaaagagaaatgattggtgtgtagagaaagaatgaatgggtgatagataaaacttattctgtccgta |
61446 |
T |
 |
| Q |
105 |
aatttcgatatccaaaggtcccaatttgttgtcatggttgttataaacatttcatttgaattagttatcttcatttcgtcttctctgtccgtattctcta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
61445 |
aatttcgatatccaaaggtcccaatttgttgtcatggttgttataaacatttcatttgaattagttatcttcatttcgtcttctctctccgtattctcta |
61346 |
T |
 |
| Q |
205 |
ttctcccaacccaatctatgtacgtgtatgcatgtattgtattgtaactgcatctc--tcgcacagacacttttgatcgaatgatcctgcccagacatat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
61345 |
ttctcccaacccaatctatgtacgtgtatgcatgtattgtattgtaactgcatctctgtagcacagacacttttgatcgaatgatcctacccagacatat |
61246 |
T |
 |
| Q |
303 |
tt-ctttttaatttgttattgtt |
324 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
61245 |
ttcctttttaatttgttattgtt |
61223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University