View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_12 (Length: 319)
Name: NF0664_low_12
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0664_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 5347203 - 5347362
Alignment:
| Q |
1 |
agaaggggagggaggtgttgatggaggagtgaaaaaggggttttggggttacaaagattgttgaaaatgagtgagtaagagagtgaagaatgatgaatgt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347203 |
agaaggtgagggaggtgttgatggaggagtgaaaaaggggttttggggttacaaagattgttgaaaatgagtgagtaagagagtgaagaatgatgaatgt |
5347302 |
T |
|
| Q |
101 |
tgttgttggaattgaagaaattgagtttgtgagaaatgtgaagtgatgggtttgagagga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347303 |
tgttgttggaattgaagaaattgagtttgtgagaaatgtgaagtgatgggtttgagagga |
5347362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 235 - 299
Target Start/End: Original strand, 5347437 - 5347501
Alignment:
| Q |
235 |
atggaagctactgtgagtaattctgaaacttgtttccatgttgaagatgaagattttgatgatgt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347437 |
atggaagctactgtgagtaattctgaaacttgtttccatgttgaagatgaagattttgatgatgt |
5347501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 785 times since January 2019
Visitors: 4099