View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_17 (Length: 285)
Name: NF0664_low_17
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0664_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 2 - 275
Target Start/End: Original strand, 4511904 - 4512177
Alignment:
| Q |
2 |
tcagttttacccttttatttagtttgaagactttgcaaaccacaatgcttttgatctacttgaaagatataggtcaacgcatcttgtttttaatgatgat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4511904 |
tcagttttacccttttatttagtttgaagactttgcaaaccacaatgcttttgatctacttgaaagatataggtcaacgcatcttgtttttaatgatgat |
4512003 |
T |
 |
| Q |
102 |
attcaggtacggaattcatgtcttaaaatatgaatttagttactattgtgaccaatatttatctcttatatgctatggactttgtttcagggaactgcag |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4512004 |
attcaggtaaggaattcatgtcttaaaatatgaatttagttactattgtgaccaatatttatctcttatatgctatggactttgtttcagggaactgcag |
4512103 |
T |
 |
| Q |
202 |
cagtggtccttgcagggatagtttcagctctaaatttggttggaggaagcttgggcgaccaccggttcttgttc |
275 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4512104 |
cagtggtccttgcaggaatagtttcagctctaaatttggttggaggaagcttgggcgaccaccggttcttgttc |
4512177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 110
Target Start/End: Complemental strand, 43433356 - 43433266
Alignment:
| Q |
20 |
ttagtttgaagactttgcaaaccacaatgcttttgatctacttgaaagatataggtcaacgcatcttgtttttaatgatgatattcaggta |
110 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||||| |||||| ||||| ||||| ||||| || || |||||||||||| |
|
|
| T |
43433356 |
ttagtttgaagacttcgcgaaccacaatgcttttgatctgcttgaaaaatatagatcaacacatctggttttcaacgacgatattcaggta |
43433266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 51497585 - 51497673
Alignment:
| Q |
22 |
agtttgaagactttgcaaaccacaatgcttttgatctacttgaaagatataggtcaacgcatcttgtttttaatgatgatattcaggta |
110 |
Q |
| |
|
|||||||||| ||||| || || |||||||| ||||| || || | ||| || ||| | ||||||||||| ||||||||||| |||||| |
|
|
| T |
51497585 |
agtttgaagattttgccaatcataatgctttcgatcttctggataaatacagctcatctcatcttgttttcaatgatgatatacaggta |
51497673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University