View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_19 (Length: 281)
Name: NF0664_low_19
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0664_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 58 - 228
Target Start/End: Complemental strand, 4179456 - 4179286
Alignment:
| Q |
58 |
attgggttgtgagatgtgaagggagggaactgtggctgtgattgtaagccatttttgtgttccaaatatctattgttacatttgttttctgatgcattgc |
157 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4179456 |
attgggttgtgagatgcgaagggagggaactgtggctgtgattgtaagccatttttgtgttccaaatatctattgttacatttgttttttgatgcattgc |
4179357 |
T |
 |
| Q |
158 |
aatttttgatcccatgctattatttacatagtaatgtaggacaggaaccatagtatccctcttttgatgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4179356 |
aatttttgatcccatgctattatttacatagtaatgtaggacaggaaccatagtatccctcttttgatgat |
4179286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University