View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_23 (Length: 254)
Name: NF0664_low_23
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0664_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 51 - 225
Target Start/End: Complemental strand, 53588477 - 53588302
Alignment:
Q |
51 |
aattgcattacaatcttaatggaagcaggtcatcgtaacgaaaatggtaaaagcgggccaccttaacgaattgccttaaaaaa-tttggaccacctcaat |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
53588477 |
aattgcattacaatcttaatggaagcaggtcatcgtaatgaaaatggtaaaagcgggccaccttaacgaactgccttaaaaaaatttggaccacctcaat |
53588378 |
T |
 |
Q |
150 |
taggacgaactgtcttacagttatcaataaaagatataattacaaaagactcttacaatacaaatgacagagaaat |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53588377 |
taggacgaactgtcttacagttatcaataaaagatataattacaaaagactcttacaatacaaatgacagagaaat |
53588302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 53588554 - 53588511
Alignment:
Q |
1 |
atggaagcttatgcaaagaggatgaaatcatcaacaaaagctag |
44 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53588554 |
atggaagcttatgcaaagaggatgaaatcatcaacaaaagctag |
53588511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University