View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_26 (Length: 251)
Name: NF0664_low_26
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0664_low_26 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 4511700 - 4511921
Alignment:
Q |
30 |
attttaaactaaagaatactgaatttgtttaaactctttgattccaggaatatgctgaacttctcgaagaattcatgacggcatgcaagcaaaattacgg |
129 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4511700 |
attttaaactaaagaatactcaatttgtttaaactctttgattccaggaatatgctgaacttctcgaagaattcatgacggcatgcaagcaaaattacgg |
4511799 |
T |
 |
Q |
130 |
agaaaaagtcctcatccaggtactaagaagtgtgcaaagacatcatttattagtttattagctcacaaatgaaacactagttttcatgttttccgttttc |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4511800 |
agaaaaagtcctcatccaggtactaagaagtgtgcaaagacatcatttattagtttattagctcacaaatgaaacactagttttcatgttttccgttttc |
4511899 |
T |
 |
Q |
230 |
tgattcagttttacccttttat |
251 |
Q |
|
|
||| |||||||||||||||||| |
|
|
T |
4511900 |
tgaatcagttttacccttttat |
4511921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University