View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_27 (Length: 251)
Name: NF0664_low_27
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0664_low_27 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 35 - 251
Target Start/End: Complemental strand, 42781166 - 42780963
Alignment:
Q |
35 |
aatgtttattaaagggcaatgaaaactgaaatgtcttatagttttatggaagatgagaagtgtgtagtttatgggcgtagtttatgtacattatttgttt |
134 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
42781166 |
aatgtttatcaaagggcaatgaaaactgaaatgtcttatagttttatggaagatgagaagtgtgtagtttatg-------------tacattatttgttt |
42781080 |
T |
 |
Q |
135 |
ctaaaagagtttatatgcattactatcggtgtaaaatgttctacaagtttattttataatatgttacatgtccaatgagtataattgtgaatggacattg |
234 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42781079 |
ctaaaagagtttatatgcattactatcggtgtaaaatgttttacaagtttattttataatatgttacatgtccaatgagtataattgtgaatggacattg |
42780980 |
T |
 |
Q |
235 |
attgatcaaagggcaac |
251 |
Q |
|
|
|||||| |||||||||| |
|
|
T |
42780979 |
attgatgaaagggcaac |
42780963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University