View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_29 (Length: 250)
Name: NF0664_low_29
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0664_low_29 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 33 - 250
Target Start/End: Original strand, 4860528 - 4860745
Alignment:
Q |
33 |
ggataaatgaatctatgataattctgttggtagcttctggttgtccattagtctaagcattcttttgttacagtgcttgctaaaacctccggtgaaagaa |
132 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4860528 |
ggatgaatgaatctatgataattctgttggtagcttctggttgtccattagtctaagcattcttttgttacagtgcttgctaaaacctccggtgaaagaa |
4860627 |
T |
 |
Q |
133 |
agcacaaagcctattgacgtgaagcttcatagtgacttgagggcaattggtcgcactgaatttgatcatcaggtgcatatttcatcaactctttctttcc |
232 |
Q |
|
|
| ||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
4860628 |
aacacaaagcctattgacgtgaaacttcatagtgatttgagggcaattggtcgcgctgaatttgatcatcaggtgcatatttcatctactctttctttcc |
4860727 |
T |
 |
Q |
233 |
cctttagttttaaacatc |
250 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
4860728 |
cctttagttttaaacatc |
4860745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University