View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_30 (Length: 249)
Name: NF0664_low_30
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0664_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 42780271 - 42780447
Alignment:
| Q |
11 |
aatatttattcttcgcagaatagacccttcaactaaaaaacttcggtgcaaatttttactattagattggttggatatttttctaaaataaaatcttact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780271 |
aatatttattcttcgcagaatagacccttcaactaaaaaacttcggtgcaaatttttactattagattggttggatatttttctaaaataaaatcttact |
42780370 |
T |
|
| Q |
111 |
gtctcctcttaccagaccatcgcaatactcttccatgtataaatgaatactattagtctttagaccaaacctttgga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780371 |
gtctcctcttaccagaccatcgcaatactcttccatgtataaatgaatactattagtctttagaccaaacctttgga |
42780447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1179 times since January 2019
Visitors: 4113