View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_35 (Length: 218)
Name: NF0664_low_35
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0664_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 47 - 197
Target Start/End: Complemental strand, 32750284 - 32750134
Alignment:
Q |
47 |
tttggaattaagacactagaaggcaaatgatttatgagataagatgcggctaaaactgccttcctaagctttttcgagaaccttattttggaatgatata |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
T |
32750284 |
tttggaattaagacactagaaggcaaatgatttatgagataagatgcagctaaaactgccttcctaagctttttcgagaaccttattttgaaataatata |
32750185 |
T |
 |
Q |
147 |
gtttgagtttgatcaaacaagtgctaatgttttctcttagcaacctcattt |
197 |
Q |
|
|
|||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
32750184 |
gtttgagtttgatcaaacaagtgcccattttttctcttagcaacctcattt |
32750134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 197
Target Start/End: Complemental strand, 50058921 - 50058780
Alignment:
Q |
58 |
gacactagaaggcaaatgatttatgagataagatgcggctaaaactgccttcct--aagctttttcgagaaccttattttggaatgatatagtttgagtt |
155 |
Q |
|
|
|||||||||||| ||| | |||||||| |||||||| | ||||||||||| || || ||| | ||||||||||||||||| | |||| | ||||| |
|
|
T |
50058921 |
gacactagaaggtaaacggtttatgaggtaagatgctgttaaaactgcctccccccaaaatttcttaggaaccttattttggaataacatagctcgagtt |
50058822 |
T |
 |
Q |
156 |
tgatcaaacaagtgctaatgttttctcttagcaacctcattt |
197 |
Q |
|
|
||||| ||||| ||| || |||||||| ||||||| ||||| |
|
|
T |
50058821 |
tgatctaacaaatgcccattttttctctcagcaaccccattt |
50058780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University