View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0664_low_6 (Length: 438)
Name: NF0664_low_6
Description: NF0664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0664_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 24 - 309
Target Start/End: Complemental strand, 22866686 - 22866401
Alignment:
| Q |
24 |
atcatcatattatttggtcatgtagctggtttcatcaatatgggtgaaaatgtctttggttgttctatttttgaacttttgaatgattcaaatatcgcct |
123 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||| |
|
|
| T |
22866686 |
atcataatattatttggtcacgtagctggtttcatcaatatgggtgaaaatgtctttggttgttctattttagaacttttgaataattcaaatatcacct |
22866587 |
T |
|
| Q |
124 |
tgattgtgtactttaaattttagaccatgcgttcataagtatgtcatatgatttccaattctacacatttgaatcttgacaattgcttcttagctatgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22866586 |
tgattgtgtactttaaattttagaccatgcgttcataagtatgtcatatgatttccaattctacacatttgaatcttgacaattgcttcttagctatgtt |
22866487 |
T |
|
| Q |
224 |
gttaatcgcggatagcaatagctgctgctgtaaagactaaaaacaacgtacaaaatacctaaattccaataggagacatagacact |
309 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
22866486 |
gttaatcgcggatagcaatagcttctgctgtaaagactaaaaacaacgtacaaactacttaaattccaataggatacatagacact |
22866401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 340 - 428
Target Start/End: Complemental strand, 22866358 - 22866269
Alignment:
| Q |
340 |
tcacctttgctccccaaggatcgcgattgtgcgattttggctcgtca-nnnnnnnggagcgatcttggcccttcatgttttcctcctttg |
428 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22866358 |
tcacttttgctccccaaggatcgcgattgtgcgattttggctcgtcattatttttggagcgatcttggcccttcatgttttcctcctttg |
22866269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 662 times since January 2019
Visitors: 4098