View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0665-Insertion-2 (Length: 163)
Name: NF0665-Insertion-2
Description: NF0665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0665-Insertion-2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 7 - 163
Target Start/End: Original strand, 41077566 - 41077722
Alignment:
| Q |
7 |
agaggtgtcaatggcagtaataaacccaggttgtgaagtaacctttcaattgatatagccgagacatttcataccggcaaggattgaattggcttgtctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077566 |
agaggtgtcaatggcagtaataaacccaggttgtgaagtaacctttcgattgatatagccgagacatttcataccggcaaggattgaattggcttgtctt |
41077665 |
T |
 |
| Q |
107 |
tgccaagtatgaaattggaagcggaaagcttgatagctatgtgagcactgagcacca |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077666 |
tgccaagtatgaaattggaagcggaaagcttgatagctatgtgagcactgagcacca |
41077722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University