View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0665-Insertion-3 (Length: 201)
Name: NF0665-Insertion-3
Description: NF0665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0665-Insertion-3 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 54277370 - 54277177
Alignment:
Q |
8 |
tagtccaccggtttttacaatgaaggagaatgcatagtccattagacccccattgcaaccattgttgtaagttgtgtcacagtcgattaattcttgctcg |
107 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54277370 |
tagtccaccgttttttacaatgaaggagaatgcatagtccattagacccccattgcaaccattgttgtaagttgtgtcacagtcgattaattcttgctcg |
54277271 |
T |
 |
Q |
108 |
gacaaagatgtcaaattccctgtcacaatttggtttattccttcaaccgcagcaacagtcgaaaatgcccagcaactacctgcaagtactcgtg |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54277270 |
gacaaagatgtcaaattccctgtcacaatttggtttattccttcaaccgcagcaacagtcgaaaatgcccagcaactacctgcaagtactcgtg |
54277177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University