View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0665-Insertion-5 (Length: 138)
Name: NF0665-Insertion-5
Description: NF0665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0665-Insertion-5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 6e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 40522659 - 40522529
Alignment:
| Q |
8 |
tatattattttattggtttttcattttccattaccctcatgatgatgttcatgtctctattttcatgttattggcaaaacaggctgcaatctagtggcat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40522659 |
tatattattttattggtttttcattttccattaccctcatgatgatgttcatgtctctattttcatgttattggcaaaacaggatgcaatctagtggcat |
40522560 |
T |
|
| Q |
108 |
caattctaacacagatcatactactgaagtg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40522559 |
caattctaacacagatcatactactgaagtg |
40522529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 47 - 106
Target Start/End: Complemental strand, 40526538 - 40526479
Alignment:
| Q |
47 |
tgatgatgttcatgtctctattttcatgttattggcaaaacaggctgcaatctagtggca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||| |||||| |||| |
|
|
| T |
40526538 |
tgatgatgttcatgtctctattttcatgttaccggcaaaacagactgctatctagaggca |
40526479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 391 times since January 2019
Visitors: 4083