View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0665_high_1 (Length: 501)
Name: NF0665_high_1
Description: NF0665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0665_high_1 |
 |  |
|
| [»] scaffold0964 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 3e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 180 - 358
Target Start/End: Complemental strand, 17354220 - 17354042
Alignment:
| Q |
180 |
tactcccccttttttgccaaaaaatatgccaaaatagagaataccagaagtatagaaatcctcagaagaacataaatttgcagaatactcataaagtgcc |
279 |
Q |
| |
|
|||| ||||||||| || | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17354220 |
tacttcccctttttagctacaaaatatgccaaaatagagaataccagaagcatagaaatcctcagaagaacataaatttgcagaatactcataaagtgcc |
17354121 |
T |
 |
| Q |
280 |
aaaagaaccaaaaagagaagaatatcaggattacagaccataggcacacttgctgctcaaattatccagggcatagccc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
17354120 |
aaaagaaccaaaaagagaagaatatcaggattagagaccataggcacacttgatgctcaaattatccagggcgtagccc |
17354042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 17354013 - 17353899
Alignment:
| Q |
387 |
ccacaggttgcaacaagaaaaatgtccaaggaatcaaacagcatcagggctactgtcagaggctttctcttcattcttattgtcagcatcttctgtttct |
486 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17354013 |
ccacaggttagaacaagaaaaatgtccaaggaatcaaacagcatcagggctactatcagaggcttcctcttcattcttattgtcagcatcttctgtttct |
17353914 |
T |
 |
| Q |
487 |
tcttcttcctcacta |
501 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17353913 |
tcttcttcctcacta |
17353899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0964 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: scaffold0964
Description:
Target: scaffold0964; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 93 - 207
Alignment:
| Q |
387 |
ccacaggttgcaacaagaaaaatgtccaaggaatcaaacagcatcagggctactgtcagaggctttctcttcattcttattgtcagcatcttctgtttct |
486 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
93 |
ccacaggttgcaacatgaaaaatgtccaaggaatcaaacagcatcagggctactgtcagaggcttcctcttcattcttattgtcagcatcttctgtttct |
192 |
T |
 |
| Q |
487 |
tcttcttcctcacta |
501 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
193 |
tcttcttcctcacta |
207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0964; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 294 - 358
Target Start/End: Original strand, 1 - 65
Alignment:
| Q |
294 |
gagaagaatatcaggattacagaccataggcacacttgctgctcaaattatccagggcatagccc |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1 |
gagaagaatattaggattacagaccataggcacacttgatgctcaaattatccagggcatagccc |
65 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 340
Target Start/End: Original strand, 25678051 - 25678085
Alignment:
| Q |
306 |
aggattacagaccataggcacacttgctgctcaaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
25678051 |
aggattacagaccataggcacacttggtgctcaaa |
25678085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University