View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0665_low_4 (Length: 319)
Name: NF0665_low_4
Description: NF0665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0665_low_4 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 97 - 319
Target Start/End: Original strand, 42831842 - 42832060
Alignment:
Q |
97 |
accaaaacctttaacattaaattttacaatgatattattcctaataagttgacctttgatatatacttggaaaatgagagtcgagcatgacattgatggc |
196 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
42831842 |
accaaaaccgttaacattaaattttacaatgatattattcctaataagttgacatttgata----cttggaaaatgagagtcgagcatgacattgatggt |
42831937 |
T |
 |
Q |
197 |
agttttactaagctttttaagatttcagttaacgtcaacaccctaaaccacgtctgacaagtgggcctgtcgttcatgaaggatggtaggcttgttggac |
296 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||| |||||| ||||||||| |
|
|
T |
42831938 |
agttttactaagctttttaaggtttcagttaacgtcaacaccctaaaccacgtctaacaagtgggcccgtcgttcacgaaggacggtaggtttgttggac |
42832037 |
T |
 |
Q |
297 |
atgctttaaattaagaaaattta |
319 |
Q |
|
|
||||||||||||| ||||||||| |
|
|
T |
42832038 |
atgctttaaattatgaaaattta |
42832060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University