View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0665_low_8 (Length: 281)
Name: NF0665_low_8
Description: NF0665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0665_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 54 - 241
Target Start/End: Complemental strand, 44373938 - 44373751
Alignment:
| Q |
54 |
tcatcatacaatatctgaattgtttgaagaagaagaaaaataaaaataattactactttgctaatacgagaaaatatcgactcattgcttaacattgcta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44373938 |
tcatcatacaatatctgaattgtttgaagaagaagaaaaataaaaataattactactttgctaatacgagaaaatattgactcattgcttaacattgcta |
44373839 |
T |
|
| Q |
154 |
ttccgttctatttccatatgcagttgacgaaggaattagctggaaagcccataaaagaagcacctgaagaccaaactctccctctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44373838 |
ttccgttctatttccatatgcagttgacgaaggaattagctggaaagcccataaaagaagcacctgaagaccaaactcttcctctgtg |
44373751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University