View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0666_high_8 (Length: 238)
Name: NF0666_high_8
Description: NF0666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0666_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 11411832 - 11411984
Alignment:
| Q |
1 |
agaaacaagtgcaacctggagctgtgcaggtgtttcaatgctttcatcttcatccattgagtctgttactaagttagtttgtgtttcatccacaaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11411832 |
agaaacaagtgcaacctggagctgtgcaggtgtttcaatgctttcatcttcatccattgagtctgttactaagttagtttgtgtttcatccacaaactct |
11411931 |
T |
 |
| Q |
101 |
gaaccagtggagctcccatcatcattgactctagccaccatgatgttttgatg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11411932 |
gaaccagtggagctcccatcatcattgactctagccaccatgatgttttgatg |
11411984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 28 - 126
Target Start/End: Complemental strand, 38524653 - 38524555
Alignment:
| Q |
28 |
aggtgtttcaatgctttcatcttcatccattgagtctgttactaagttagtttgtgtttcatccacaaactctgaaccagtggagctcccatcatcatt |
126 |
Q |
| |
|
||||||| || ||||||||||||| |||| || | |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
38524653 |
aggtgttccagtgctttcatcttcttccaccgattatgttactaagttagtttgtgttgcatccacaaactctgaaccaatggagctcccatcttcatt |
38524555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University