View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0666_high_9 (Length: 221)
Name: NF0666_high_9
Description: NF0666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0666_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 3166536 - 3166413
Alignment:
Q |
1 |
aatggaacatggcttagataaatcctagtaagcataggattaaaaaacatgttttatttaataggtaaatttatttcaatggttagaccttgtgttttgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
3166536 |
aatggaacatggcttagataaatcctagtaagcataggattaaaaa-catgttttatttaataggtaaatttatttcaatggttaaaccttgtgttttgt |
3166438 |
T |
 |
Q |
101 |
tgtcattcccaaaaacatatcaact |
125 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
3166437 |
tgtcattcccaaaaacatatcaact |
3166413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 206
Target Start/End: Complemental strand, 3166391 - 3166332
Alignment:
Q |
147 |
caaatccaaacgacagcttaagnnnnnnnngttgaaattgagcatgttttgttgatgatg |
206 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
3166391 |
caaatccaaacgacagcttaagttttttttgttgaaattgagcatgttttgttgatgatg |
3166332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3386 times since January 2019
Visitors: 4034