View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0667_low_12 (Length: 369)

Name: NF0667_low_12
Description: NF0667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0667_low_12
NF0667_low_12
[»] chr3 (3 HSPs)
chr3 (21-178)||(2782514-2782671)
chr3 (273-349)||(2782343-2782419)
chr3 (10-89)||(18973100-18973179)
[»] chr2 (1 HSPs)
chr2 (10-170)||(42048555-42048715)
[»] chr8 (2 HSPs)
chr8 (10-176)||(31180275-31180440)
chr8 (10-89)||(40530935-40531014)
[»] chr1 (1 HSPs)
chr1 (10-50)||(38564604-38564644)
[»] chr7 (2 HSPs)
chr7 (12-61)||(26231835-26231884)
chr7 (10-41)||(46262465-46262496)
[»] chr6 (1 HSPs)
chr6 (12-50)||(12128599-12128637)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 2782671 - 2782514
Alignment:
Q  21 tgcaattgtggtggatccagtctctggatggttggtggtttatctcctttacgatgaaagacggtacatcaagtagcttgatgttgctacgggatcactg 120  Q
    ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||| |||| |||| |||    
T  2782671 tgcaattgtggtggatccagtctttagatggttggtggtttatctcctttacgatgaaaggcggtacattaagtagcttgctgttggtacgagatcgctg 2782572  T
Q  121 tgcttcgggtgtttgcgtgtggtttctgtggatctctggtgttgttgttggggtgcgt 178  Q
    ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||    
T  2782571 tgcttcgggtgtttgcgtgtggtttctgtggatctctagtggtgttgttggggtgcgt 2782514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 273 - 349
Target Start/End: Complemental strand, 2782419 - 2782343
Alignment:
Q  273 cctttggatgttttccctacgcgttctagggtttgtttgtagggattggtgatgttgttttgctgtcttgatgatgt 349  Q
    ||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||| || ||||||| ||||||    
T  2782419 cctttggatgttttccctacgcgttatggggtttgtttgtagggattggtgatgatgttatgttgtcttggtgatgt 2782343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 18973100 - 18973179
Alignment:
Q  10 gcaaagggtcgtgcaattgtggtggatccagtctctggatggttggtggtttatctcctttacgatgaaagacggtacat 89  Q
    ||||||||||||||| |||||||||||||||||| |||||| || | | ||| ||||||   ||| ||||||||||||||    
T  18973100 gcaaagggtcgtgcagttgtggtggatccagtctttggatgatttgagatttttctcctccgcgaagaaagacggtacat 18973179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 10 - 170
Target Start/End: Complemental strand, 42048715 - 42048555
Alignment:
Q  10 gcaaagggtcgtgcaattgtggtggatccagtctctggatggttggtggtttatctcctttacgatgaaagacggtacatcaagtagcttgatgttgcta 109  Q
    |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||  |||||||||| |||||   ||||| |||| ||||  ||    
T  42048715 gcaaagggtcttgcagttgtggtggatccagtctctggatggttggtggtttatctccttcgcgatgaaagatggtacggtaagtatcttgttgtttgta 42048616  T
Q  110 cgggatcactgtgcttcgggtgtttgcgtgtggtttctgtggatctctggtgttgttgttg 170  Q
    |||| ||  ||||| | ||||||| ||||||||||| | ||||||||||||| ||||||||    
T  42048615 cggggtcgttgtgcgttgggtgttcgcgtgtggtttatatggatctctggtggtgttgttg 42048555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 10 - 176
Target Start/End: Complemental strand, 31180440 - 31180275
Alignment:
Q  10 gcaaagggtcgtgcaattgtggtggatccagtctctggatggttggtggtttatctcctttacgatgaaagacggtacatcaagtagcttgatgttgcta 109  Q
    ||||||||||||||| ||||||||||| |||||| ||||||||||||||| | |||||||  ||  |||||| ||||||  |||||||||| ||||| |     
T  31180440 gcaaagggtcgtgcagttgtggtggattcagtctttggatggttggtggtgtctctccttcgcgccgaaagaaggtacaataagtagcttgttgttggtt 31180341  T
Q  110 cgggatcactgtgcttcgggtgtttgcgtgtggtttctgtggatctctggtgttgttgttggggtgc 176  Q
     ||||| | |||||||  |||||||||| || |||| |||| |||| ||||| ||||| || |||||    
T  31180340 tgggataattgtgctttaggtgtttgcgagt-gtttatgtgaatctttggtggtgttggtgtggtgc 31180275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 40530935 - 40531014
Alignment:
Q  10 gcaaagggtcgtgcaattgtggtggatccagtctctggatggttggtggtttatctcctttacgatgaaagacggtacat 89  Q
    ||||||||||||||| ||||||||||||||||| ||||||| || | | ||| |||||||  ||| ||||||||||||||    
T  40530935 gcaaagggtcgtgcagttgtggtggatccagtccctggatgatttgagatttttctccttcgcgaagaaagacggtacat 40531014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 38564604 - 38564644
Alignment:
Q  10 gcaaagggtcgtgcaattgtggtggatccagtctctggatg 50  Q
    ||||||||||||||| |||||||||||||||||||||||||    
T  38564604 gcaaagggtcgtgcagttgtggtggatccagtctctggatg 38564644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 26231835 - 26231884
Alignment:
Q  12 aaagggtcgtgcaattgtggtggatccagtctctggatggttggtggttt 61  Q
    |||||||||||   |||||||||||||||| |||||||||||||||||||    
T  26231835 aaagggtcgtgtggttgtggtggatccagtttctggatggttggtggttt 26231884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 10 - 41
Target Start/End: Complemental strand, 46262496 - 46262465
Alignment:
Q  10 gcaaagggtcgtgcaattgtggtggatccagt 41  Q
    ||||||||||||||||||||||||||||||||    
T  46262496 gcaaagggtcgtgcaattgtggtggatccagt 46262465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 12 - 50
Target Start/End: Original strand, 12128599 - 12128637
Alignment:
Q  12 aaagggtcgtgcaattgtggtggatccagtctctggatg 50  Q
    |||||| |||||| |||||||||||||||||||||||||    
T  12128599 aaagggccgtgcagttgtggtggatccagtctctggatg 12128637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3083 times since January 2019
Visitors: 4027