View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0667_low_14 (Length: 276)
Name: NF0667_low_14
Description: NF0667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0667_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 97 - 261
Target Start/End: Original strand, 7907152 - 7907317
Alignment:
Q |
97 |
attcatctcactctgtattcactccaatggagttttctattctacattgtgaacttctacaatgcaaaaatacattcattattttcctnnnnnnnttaga |
196 |
Q |
|
|
|||||| || |||| ||||||||||| | |||||||||||||||||||||||| || |||||||||||||||||||||| ||| || | ||||| |
|
|
T |
7907152 |
attcatttctctctttattcactccagttgagttttctattctacattgtgaatttttacaatgcaaaaatacattcatgattgtcttaaaaatattaga |
7907251 |
T |
 |
Q |
197 |
ttagagagttgcaaacca-tctaaaccccaatggttttgaatgaaaaagtaagttgaatgatgatg |
261 |
Q |
|
|
|| ||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
T |
7907252 |
ttggagagttgcaaaccattctaaaccccaatggttttgaattaaaaactaagttgaacgatgatg |
7907317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 96
Target Start/End: Complemental strand, 7935097 - 7935028
Alignment:
Q |
27 |
attccctccaagggtttccaatattgagaccaacaagccaaattgaattgacttggttaatgaagattgt |
96 |
Q |
|
|
|||||||| ||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
7935097 |
attccctcaaagtgcttccaatattgagaccaacaagccatattgaattgacttggttaatgaagattgt |
7935028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University