View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0667_low_14 (Length: 276)

Name: NF0667_low_14
Description: NF0667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0667_low_14
NF0667_low_14
[»] chr6 (2 HSPs)
chr6 (97-261)||(7907152-7907317)
chr6 (27-96)||(7935028-7935097)


Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 97 - 261
Target Start/End: Original strand, 7907152 - 7907317
Alignment:
97 attcatctcactctgtattcactccaatggagttttctattctacattgtgaacttctacaatgcaaaaatacattcattattttcctnnnnnnnttaga 196  Q
    |||||| || |||| ||||||||||| | |||||||||||||||||||||||| || |||||||||||||||||||||| ||| || |       |||||    
7907152 attcatttctctctttattcactccagttgagttttctattctacattgtgaatttttacaatgcaaaaatacattcatgattgtcttaaaaatattaga 7907251  T
197 ttagagagttgcaaacca-tctaaaccccaatggttttgaatgaaaaagtaagttgaatgatgatg 261  Q
    || ||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||| |||||||    
7907252 ttggagagttgcaaaccattctaaaccccaatggttttgaattaaaaactaagttgaacgatgatg 7907317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 96
Target Start/End: Complemental strand, 7935097 - 7935028
Alignment:
27 attccctccaagggtttccaatattgagaccaacaagccaaattgaattgacttggttaatgaagattgt 96  Q
    |||||||| ||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
7935097 attccctcaaagtgcttccaatattgagaccaacaagccatattgaattgacttggttaatgaagattgt 7935028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University