View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0667_low_16 (Length: 251)
Name: NF0667_low_16
Description: NF0667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0667_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 10470377 - 10470592
Alignment:
| Q |
16 |
agctagtagtgatattcacaatgtatggcaaggagctgcagattttcttctgcagaattttgcagtaaatgggctggttgtaggtgctttgaggtaatgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470377 |
agctagtagtgatattcacaatgtatggcaaggagctgcagattttcttctgcagaattttgcagtaaatgggctggttgtaggtgctttgaggtaatgc |
10470476 |
T |
|
| Q |
116 |
catgttgtgggttgggagtgattttcttctgaacaataaatttttagtcttgttataggtgctgtctaaaactaggaagctttgttttggcatgcttaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470477 |
catgttgtgggttgggagtgattttctgctgaacaataaagttttagtcttgttataggtgctgtctaaaactaggaagctttgttttggcatgcttaag |
10470576 |
T |
|
| Q |
216 |
tgttcaaggatgatgt |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10470577 |
tgttcaaggatgatgt |
10470592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 209
Target Start/End: Original strand, 42721366 - 42721457
Alignment:
| Q |
118 |
tgttgtgggttgggagtgattttcttctgaacaataaatttttagtcttgttataggtgctgtctaaaactaggaagctttgttttggcatg |
209 |
Q |
| |
|
|||||||||| ||||||||| || | || ||||| |||||||| | |||||||||| ||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
42721366 |
tgttgtgggtcgggagtgatcttgtattgtacaatcaatttttaattttgttataggggctgtaaaaaactaggaaactttgttttagcatg |
42721457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3122 times since January 2019
Visitors: 4028