View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_high_13 (Length: 285)
Name: NF0668_high_13
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 64 - 241
Target Start/End: Complemental strand, 46360377 - 46360200
Alignment:
| Q |
64 |
ccgcgaagcaaaaattagatggaggtagtgcgatactagtacgattagtagtagcaacaaacaagtagagaagacagaaaaaactgggacatttctcaat |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46360377 |
ccgcgaagcaaaaattagatggaggtagtgcgatactggtacgattagtagtagcaacaaacaagtagagaagacagaaaaaagtgggacatttctcaat |
46360278 |
T |
 |
| Q |
164 |
tctcaccccatttcctcatgcctgtaggattcgatcttttgccaacagccaaatacttttctttgcattcatattctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46360277 |
tctcaccccatttcctcatgcctgtaggattcgatcttttgccaacagccaaatacttttctttgcattcattttctt |
46360200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University