View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_high_16 (Length: 271)
Name: NF0668_high_16
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0668_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 27 - 128
Target Start/End: Original strand, 42325447 - 42325548
Alignment:
Q |
27 |
tcgaagaatatgcaactccatttacaatattggtttgattcacattcaacccgatcttgcaatggacattagacttatttatgatcttaatgttgttgat |
126 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
T |
42325447 |
tcgatgaaaatgcaactccatttacaatattggtttgattcacattcaacccgatcttgcaatggaccttagaattatttatgatcttaatgttgttgat |
42325546 |
T |
 |
Q |
127 |
ta |
128 |
Q |
|
|
|| |
|
|
T |
42325547 |
ta |
42325548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 98 - 158
Target Start/End: Original strand, 42315705 - 42315765
Alignment:
Q |
98 |
gacttatttatgatcttaatgttgttgattacgtgaacctattatctggttataataaaaa |
158 |
Q |
|
|
|||| ||||||||||||||| ||||||||||| ||| |||||||| || |||||||||||| |
|
|
T |
42315705 |
gactaatttatgatcttaatattgttgattacttgagcctattatgtgtttataataaaaa |
42315765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 195
Target Start/End: Original strand, 42315791 - 42315831
Alignment:
Q |
155 |
aaaaagcctttcatttgtccagagtcctacaatgaggtgga |
195 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |||||| |
|
|
T |
42315791 |
aaaaagcctttcatttgtcctgagtcctacaatgtggtgga |
42315831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University