View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_high_4 (Length: 357)
Name: NF0668_high_4
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0668_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 99 - 346
Target Start/End: Complemental strand, 8220524 - 8220277
Alignment:
Q |
99 |
tcaatttcaatagtggaatgtgaatcctttgacatatagtataagtgtgagtcaaattctatgcacaactagtataaatcatatcaatatattggtcccc |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
8220524 |
tcaatttcaatagtggaatgtgaatcctttgacatatagtataagtgtgggtcaaattctatgcacgactagtataaatcatatcaatatattggtcccc |
8220425 |
T |
 |
Q |
199 |
accatgagactaaatagttaaatttttacagactatactaattggccattgttacctgtgctttcagtaccagaaaaacataggatttataacattaaca |
298 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8220424 |
accatgagactaaatagttaaatttttacagactatactaattggccattgttacctgtgctttcagtaccagaaaaacataggatttataacattaaca |
8220325 |
T |
 |
Q |
299 |
tgcatatctgaacaaagatgagattgagcatacaaatggtccgttcat |
346 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8220324 |
tgcatatctgaacaaagatgagattgagcatacaaatggtccgttcat |
8220277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 733 times since January 2019
Visitors: 4098