View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_high_5 (Length: 356)
Name: NF0668_high_5
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 40 - 342
Target Start/End: Original strand, 55162647 - 55162949
Alignment:
| Q |
40 |
atacattgggatatcagtaacgaaatgcttcattttgatttctacgaacaaaggcttggacccaatgctacatttcatttctttgaggcagcacatgaat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162647 |
atacattgggatatcagtaacgaaatgcttcattttgatttctacgaacaaaggcttggacccaatgctacatttcatttctttgaggcagcacatgaat |
55162746 |
T |
|
| Q |
140 |
cagatcctctagcaactctgtttatgaatgacttcaatgttgtagaaacgtgcagtgatgtaaattctagcgttgacgcttatatctcgcgaataagaga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162747 |
cagatcctctagcaactctgtttatgaatgacttcaatgttgtagaaacgtgcagtgatgtaaattctagcgttgacgcttatatctcgcgaataagaga |
55162846 |
T |
|
| Q |
240 |
actaagacaatatggtgtttttatggatggaattggtctcgagggtcacttcacaataccaaatcttccacttataagagctatcctagacaaattggca |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162847 |
actaagacaatatggtgtttttatggatggaattggtctcgagggtcacttcacaataccaaatcttccacttataagagctatcctagacaaattggca |
55162946 |
T |
|
| Q |
340 |
aca |
342 |
Q |
| |
|
||| |
|
|
| T |
55162947 |
aca |
55162949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 653 times since January 2019
Visitors: 4096