View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_high_9 (Length: 348)
Name: NF0668_high_9
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0668_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 93 - 196
Target Start/End: Complemental strand, 46442404 - 46442301
Alignment:
Q |
93 |
agtatgtagaatcatcttatcatatttttatggcgatttttatattattggactgttcttcacacaccctgtatagcatttttataatgcaatattttta |
192 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46442404 |
agtatgtagaatcatcttatcatatttttatggcgatttttatattattggtctgttcttcacacaccctgtatagcatttttataatgcaatattttta |
46442305 |
T |
 |
Q |
193 |
attt |
196 |
Q |
|
|
|||| |
|
|
T |
46442304 |
attt |
46442301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 191
Target Start/End: Complemental strand, 46429452 - 46429358
Alignment:
Q |
98 |
gtagaatcatcttatcatattttt-atggcgatttttatattattggactgttcttcacacaccctgtatagcatttttataatgcaatattttt |
191 |
Q |
|
|
|||||||||||||||||||||||| |||| |||||| ||||||||| |||||||||||||||| ||| ||||||||||| |||||||| ||||| |
|
|
T |
46429452 |
gtagaatcatcttatcatattttttatggtaatttttgtattattggtctgttcttcacacaccttgtgtagcatttttaaaatgcaattttttt |
46429358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 217 - 298
Target Start/End: Complemental strand, 46442287 - 46442206
Alignment:
Q |
217 |
caagaataatgccatagacattgtactaaatttagtnnnnnnntaaataaatataacaactatccgcca-aaaagctattcaa |
298 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
46442287 |
caagaataatgccatagacattgtgctaaatttagtaaaaaa-taaataaatataacaactatccgccaaaaaagctattcaa |
46442206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 272 - 314
Target Start/End: Complemental strand, 46429307 - 46429265
Alignment:
Q |
272 |
acaactatccgccaaaaagctattcaaattgaggtgcgctgat |
314 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
46429307 |
acaactatccgccaaaaagctcttcaaattgaggtgcgctgat |
46429265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University