View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_11 (Length: 357)
Name: NF0668_low_11
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 307
Target Start/End: Complemental strand, 8417184 - 8416908
Alignment:
| Q |
13 |
aatatcacgaattcaatagtctaatccttcttcttaatgctccaagctaaccctgcatattgaaaacaatcaaatagataaaccatattccaacaatcaa |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417184 |
aatatcacgaattcaatattctaatccttcttcttaatgctccaagctaaccctgcatattgaaaacaatcaaatagataaaccatattccaacaatcaa |
8417085 |
T |
 |
| Q |
113 |
gtgaaatgtgtgaccatatttcttgaaagcttgcagcaaaatctaatactccctccggagggagtaataaatctatgcagagagcagctcgaatcctgac |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417084 |
gtgaaatgtgtgaccatatttcttgaatgcttgcagcaaaatctaa------------------taataaatctatgcagagagcagctcgaatcctgac |
8417003 |
T |
 |
| Q |
213 |
tcattcttataggaacttgttgctcgttaatcaacaaacaattcagtgccaactttcaaataaaacctatgacaacatcatattttatcgacact |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417002 |
tcattcttataggaacttgttgctcgttaatcaacaaacaattcagtgccaactttcaaataaaacctatgacaacatcatattttatcgacact |
8416908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University