View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_26 (Length: 327)
Name: NF0668_low_26
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 28 - 292
Target Start/End: Complemental strand, 47364418 - 47364146
Alignment:
| Q |
28 |
taatatcatatgggattgctttgaaatcaacaaacattctttagtgtacgtagtatctgacagatacagtgacacccaagaatgttgaactttagatttt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364418 |
taatatcatatgggattgctttgaaatcaacaaacattctttagtgtacgtagtatctgacagatacagtgacacccaagaatgttgaactttagatttt |
47364319 |
T |
|
| Q |
128 |
tagttactacaatgtgcatatat--------caagatatacttcatgatgagctttttcttttcaaagtgcgggtcttcaggagcatgaaagaaacagac |
219 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364318 |
tagttactacaatgtgcatatatatatatatcaagatatactacattatgagctttttcttttcaaagtgcgggtcttcaggagcatgaaagaaacagac |
47364219 |
T |
|
| Q |
220 |
tcactttgttttcattttaaaagagcatctcatggaccccttctattagagcattcacaatggatttatccat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364218 |
tcactttgttttcattttaaaagagcatctcatggaccccttctattagagcattcacaatggatttatccat |
47364146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 617 times since January 2019
Visitors: 4091