View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_46 (Length: 281)
Name: NF0668_low_46
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 53 - 240
Target Start/End: Original strand, 26498702 - 26498891
Alignment:
| Q |
53 |
atcatcagaaaacgaatagaccacatactacaaaccaaacaccaggacaacaaattagtatacattccttctatcatgaatattcagtcaagtttcccat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26498702 |
atcatcagaaaacgaatagaccacatactacaaaccaaacaccaggacaacaaattagtatccattccttctatcatgaatattcagtcaagtttcccat |
26498801 |
T |
 |
| Q |
153 |
tgttaaaccacttgcgtaatccccatcgtgctttctcttacatatatctaaggatacaagttgtaggct--atccaaactgctctgtgct |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| ||| ||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
26498802 |
tgttaaaccacttgcataatccccatcgtgctttttcttacatatacctatggatacaagttgttggctccgtcaaaactgctctgtgct |
26498891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University