View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0668_low_51 (Length: 273)

Name: NF0668_low_51
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0668_low_51
NF0668_low_51
[»] chr1 (1 HSPs)
chr1 (79-236)||(26232137-26232294)


Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 79 - 236
Target Start/End: Complemental strand, 26232294 - 26232137
Alignment:
79 atcatgagtatcatgtatgatttaacttctttaaaaaatgagtatctttataaaataattgatttccttgccttagacaacgatctacctctccaaaatt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26232294 atcatgagtatcatgtatgatttaacttctttaaaaaatgagtatctttataaaataattgatttccttgccttagacaacgatctacctctccaaaatt 26232195  T
179 gattttgtttcaaaccccataatgccttagacaactatctacctccccatgaattgat 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26232194 gattttgtttcaaaccccataatgccttagacaactatctacctccccatgaattgat 26232137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1081 times since January 2019
Visitors: 4112