View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_52 (Length: 272)
Name: NF0668_low_52
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 116 - 245
Target Start/End: Original strand, 28470154 - 28470283
Alignment:
| Q |
116 |
tatttgtttaaatgatgatttatagatcaactttaatgtccttaaagaatttattagggtatgtccgcactagttttattattcaattggtaaagccatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28470154 |
tatttgtttaaatgatgatttatagatccactttaatgtccttaaagaatttattacggtatgtccgcactagttttattattcaattggtaaagccatc |
28470253 |
T |
|
| Q |
216 |
cttaaattacttcccatgcgttggtctctg |
245 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
28470254 |
cttaaattacttcccatgcgttggcctctg |
28470283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 44 - 117
Target Start/End: Original strand, 28469812 - 28469884
Alignment:
| Q |
44 |
cttttatgttcgacaactcctcacccttcacatacttttatgcaaagttatttccaaaacaactcacattaata |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| | || ||| |||||||||||||| |
|
|
| T |
28469812 |
cttttatgttggacaactcctcacccttcacatacttttatgcaaagttttatctgaaa-aactcacattaata |
28469884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1243 times since January 2019
Visitors: 4114