View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_53 (Length: 272)
Name: NF0668_low_53
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0668_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 41746951 - 41746745
Alignment:
| Q |
1 |
aattaaaaacaatgtgatggcatgcacatgagtgagaaaaactaaggataacaccccatcgtagtggacgcgaatgagtaatgagtaattagacgttaat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41746951 |
aattaaaaacaatgtgatggcgtgcacatgagtgagaaaaactaaggataacaccccatcgtagtggacgcgaatgagtaatgagtaattagacgttaat |
41746852 |
T |
 |
| Q |
101 |
gcaaatgcaaatgcaaattaaaatgcatacactgcatatgattatgataatggtgcagcttggttctataattgcaattaaatgattccaaaacttatta |
200 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41746851 |
gcaaatgtaaat------taaaatgcatacactgcatatgattatgataatggtgcagcttggttctataattgcaattaaatgattccaaaacttatta |
41746758 |
T |
 |
| Q |
201 |
acacaccactttc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41746757 |
acacaccactttc |
41746745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University