View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_61 (Length: 243)
Name: NF0668_low_61
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0668_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 52 - 119
Target Start/End: Complemental strand, 35207205 - 35207138
Alignment:
Q |
52 |
aataccttccctactcaaaaaccatacgccagagaaacaaaacgccaaatccaaattcttctcatatt |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35207205 |
aataccttccctactcaaaaaccatacgccagagaaacaaaacgccaaatccaaattcttctcatatt |
35207138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 666 times since January 2019
Visitors: 4098