View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_66 (Length: 211)
Name: NF0668_low_66
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0668_low_66 |
 |  |
|
[»] scaffold0607 (1 HSPs) |
 |  |  |
|
[»] scaffold0292 (1 HSPs) |
 |  |  |
|
[»] scaffold0009 (1 HSPs) |
 |  |  |
|
[»] scaffold0006 (1 HSPs) |
 |  |  |
|
[»] scaffold0437 (2 HSPs) |
 |  |  |
|
[»] scaffold0012 (2 HSPs) |
 |  |  |
|
[»] scaffold0134 (1 HSPs) |
 |  |  |
|
[»] scaffold0068 (1 HSPs) |
 |  |  |
|
[»] scaffold0886 (1 HSPs) |
 |  |  |
|
[»] scaffold0363 (1 HSPs) |
 |  |  |
|
[»] scaffold0007 (1 HSPs) |
 |  |  |
|
[»] scaffold1821 (1 HSPs) |
 |  |  |
|
[»] scaffold0093 (1 HSPs) |
 |  |  |
|
[»] scaffold0196 (1 HSPs) |
 |  |  |
|
[»] scaffold0314 (1 HSPs) |
 |  |  |
|
[»] scaffold0216 (1 HSPs) |
 |  |  |
|
[»] scaffold0029 (1 HSPs) |
 |  |  |
|
[»] scaffold0002 (1 HSPs) |
 |  |  |
|
[»] scaffold0546 (1 HSPs) |
 |  |  |
|
[»] scaffold0109 (1 HSPs) |
 |  |  |
|
[»] scaffold0265 (1 HSPs) |
 |  |  |
|
[»] scaffold0291 (1 HSPs) |
 |  |  |
|
[»] scaffold0020 (1 HSPs) |
 |  |  |
|
[»] scaffold0125 (1 HSPs) |
 |  |  |
|
[»] scaffold0001 (1 HSPs) |
 |  |  |
|
[»] scaffold0553 (1 HSPs) |
 |  |  |
|
[»] scaffold0356 (1 HSPs) |
 |  |  |
|
[»] scaffold0166 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 3e-25; HSPs: 27)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 10423857 - 10423787
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||| |
|
|
T |
10423857 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttgatgcttgtccactctccttgctta |
10423787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 27035904 - 27035838
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||||| |||| |||||||||||||| |||| |
|
|
T |
27035904 |
tctcgggatgccaacctagttgggatgtcgatgatgcctcttgatgcttgtcctctctccttactta |
27035838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 13309431 - 13309362
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||| |||| ||||| ||||||| | |||||| |
|
|
T |
13309431 |
tctcggggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtccactctcctggtttatat |
13309362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 24961874 - 24961942
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||| | ||| ||||||||||||||||||||| |
|
|
T |
24961874 |
tctcggggtgccaacctagttgggatgtcgatgatgtctcctgatgtctgtcctctctccttgcttata |
24961942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 71
Target Start/End: Complemental strand, 2583125 - 2583065
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||| ||||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
T |
2583125 |
ggtgccaacttagttgggatgtcgatgatgcctcttgatgtctgtcctctctccttgctta |
2583065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 6 - 73
Target Start/End: Complemental strand, 11779376 - 11779309
Alignment:
Q |
6 |
ctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||| ||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
11779376 |
ctcggggtgccaacctaattgggataccgatgttgcctcttgatgtctgtcctctctccttacttata |
11779309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 23487477 - 23487544
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| |||| |||||||| ||||||||| |||||| | |||| |||||||||||||||||||| |
|
|
T |
23487477 |
tctcggggtaccaatctagttggaatgtcgatgatgcctcctgatgcctgtcctctctccttgcttat |
23487544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 34528975 - 34528908
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| |||| |||||| |||| || |||||||||||| |
|
|
T |
34528975 |
ggtttcccggggtgccaacctagttgggatgtcgctgtttcctcttgatgcccgttctctctccttgc |
34528908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 35877005 - 35877068
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| ||| ||||| || |||||||||||| |
|
|
T |
35877005 |
gggtgccaacctagttgggatgtcgatgttgcttcttgatgtttgtccactatccttgcttata |
35877068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 65
Target Start/End: Complemental strand, 18332750 - 18332693
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||| |||| | |||||| |
|
|
T |
18332750 |
cggggtgccaacctagttgggatgtcgatgttttctcttaatgcttgtcttttctcct |
18332693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 19054434 - 19054385
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
T |
19054434 |
cggggtgccaacctagttgggatgtcggtgtttcctcttgatgcatgtcc |
19054385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 73
Target Start/End: Complemental strand, 20808797 - 20808740
Alignment:
Q |
16 |
caacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||| ||||||||||||||||| || ||||| |||| ||||||||||||||||||||| |
|
|
T |
20808797 |
caacttagttgggatgtcgatgatgtctcttgatgcctgtcctctctccttgcttata |
20808740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 74
Target Start/End: Complemental strand, 1624087 - 1624020
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
||||||| |||||||||||||||| | ||||||||||||| ||| ||||| |||||||| ||||||| |
|
|
T |
1624087 |
tcggggtaccaacctagttgggatattgatgttgcctcttgatgtgtgtccactctcctttcttatat |
1624020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 16280457 - 16280524
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||| ||| |||||||||||||| |||| ||| ||| ||||| |||||||||||||| |
|
|
T |
16280457 |
tctcggggtgccaatctaattgggatgtcgatgatgccgcttgatgtttgtccactctccttgcttat |
16280524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 34517701 - 34517772
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||| ||||||||| |||||||||||||||| | |||| |||| |||| | ||||||||||||| |
|
|
T |
34517701 |
ggtttctcgggatgccaaccttattgggatgtcgatgtttcttcttgatgcttgtcatttctccttgcttat |
34517772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 21813189 - 21813255
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||| ||| | ||| | ||||||||||| |
|
|
T |
21813189 |
tctcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttttccacactccttgctta |
21813255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 2 - 64
Target Start/End: Original strand, 26189220 - 26189282
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
||||||||| ||| |||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
T |
26189220 |
gtttctcggagtgtcaacctagttggaatatcgatgttttctcttaatgcatgtccactctcc |
26189282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 26505910 - 26505971
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
||||||||||||||||| ||| |||| |||| |||||| ||||||||||||||||||||| |
|
|
T |
26505910 |
tcggggtgccaacctagctggtttgtcagtgtttcctcttgatgcatgtcctctctccttgc |
26505971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 907711 - 907647
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgct |
69 |
Q |
|
|
|||| ||||||||| |||||||||||||||||| || ||||| ||| |||| |||||||||||| |
|
|
T |
907711 |
tctcagggtgccaatctagttgggatgtcgatgatgtctcttgatgtctgtcatctctccttgct |
907647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 21464796 - 21464828
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
21464796 |
tctcggggtgccaacctagttgggatgtcgatg |
21464828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 64
Target Start/End: Complemental strand, 16816277 - 16816227
Alignment:
Q |
14 |
gccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
||||||||||||||||||| | |||| |||||| |||||||||| |||||| |
|
|
T |
16816277 |
gccaacctagttgggatgttggtgtttcctcttgatgcatgtccactctcc |
16816227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 69
Target Start/End: Original strand, 19088910 - 19088964
Alignment:
Q |
15 |
ccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgct |
69 |
Q |
|
|
|||||||| ||| |||||| |||| |||||| |||||||||||||||||||||| |
|
|
T |
19088910 |
ccaacctaattgagatgtcagtgtttcctcttgatgcatgtcctctctccttgct |
19088964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Complemental strand, 22522850 - 22522820
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
22522850 |
tctcggggtgccaacctagttgggatgtcga |
22522820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 3833475 - 3833439
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctc |
44 |
Q |
|
|
||||||||||||||||||||||||||| ||| ||||| |
|
|
T |
3833475 |
cggggtgccaacctagttgggatgtcggtgtagcctc |
3833439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 10032129 - 10032077
Alignment:
Q |
16 |
caacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
||||||||||||||||||| |||| |||||| |||| ||||| ||||||||| |
|
|
T |
10032129 |
caacctagttgggatgtcggtgtttcctcttgatgcctgtcccttctccttgc |
10032077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 71
Target Start/End: Original strand, 14986127 - 14986175
Alignment:
Q |
23 |
gttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||| ||||||| |||| |||||| |||||||||||||||| ||||||| |
|
|
T |
14986127 |
gttgtgatgtcggtgtttcctcttgatgcatgtcctctctcattgctta |
14986175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 21487886 - 21487822
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||||||||||||||||||||||||| | |||||| |||| ||||| ||||||| ||||| |
|
|
T |
21487886 |
tcggggtgccaacctagttgggatgtcgtcacttcctcttgatgcctgtccactctcctggctta |
21487822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 5e-24; HSPs: 39)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 12435976 - 12436048
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
T |
12435976 |
ggtttgtcggggtgccaacctagttgggatgtcgatgatgcctcctgatgcatgtcctctctccttgcttata |
12436048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 9351180 - 9351109
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| || || |||||||||| ||||||| |||||| |
|
|
T |
9351180 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgtctattgatgcatgtccactctcctcgcttat |
9351109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 32569852 - 32569923
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| |||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
32569852 |
ggtttctcgaggtgtcaatctagttgggatgtcgatgttgcctcttaatgactgtcctctctccttgcttat |
32569923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 3056959 - 3057030
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||| ||||| |||||||||||||||||||| ||||| |||| ||||| |||||||||||||| |
|
|
T |
3056959 |
ggtttctcggggtaccaacttagttgggatgtcgatgttgtctcttgatgcctgtccactctccttgcttat |
3057030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 20898992 - 20899051
Alignment:
Q |
9 |
ggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| |
|
|
T |
20898992 |
ggggtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctccttgc |
20899051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 3 - 73
Target Start/End: Complemental strand, 14372240 - 14372170
Alignment:
Q |
3 |
tttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
T |
14372240 |
tttctcggagtgccaacctagttgggatgtcgatgttgcctcttgatgtctgtccattctccttgcttata |
14372170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 71
Target Start/End: Original strand, 13570488 - 13570557
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||| ||||||||||||| | |||| |||||| ||||||||||||||||| |||||| |
|
|
T |
13570488 |
gtttctcggggtgccaatctagttgggatgtaggtgttccctcttgatgcatgtcctctctccctgctta |
13570557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 71
Target Start/End: Original strand, 13565946 - 13566005
Alignment:
Q |
12 |
gtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||||||||| |||| |||||| ||||||||||||||||| |||||| |
|
|
T |
13565946 |
gtgccaacctagttgggatgtcgttgttccctcttgatgcatgtcctctctccctgctta |
13566005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 13575023 - 13575093
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||| |||| |||||| ||||||||| ||||||| |||||| |
|
|
T |
13575023 |
ggtttcccggagtgccaacctagttgggatgtcggtgttccctcttgatgcatgtcttctctccctgctta |
13575093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 13577562 - 13577632
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||| |||| |||||| ||||||||| ||||||| |||||| |
|
|
T |
13577562 |
ggtttcccggagtgccaacctagttgggatgtcggtgttccctcttgatgcatgtcttctctccctgctta |
13577632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 71
Target Start/End: Complemental strand, 18306775 - 18306714
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||||||||||||||||||||||||| || ||| | |||| ||||||||||||||||||| |
|
|
T |
18306775 |
gggtgccaacctagttgggatgtcgatgatgactcctgatgcctgtcctctctccttgctta |
18306714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 24127880 - 24127808
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| ||||||||||||| ||||||||||||| | |||||| ||| |||||||||| |||||||||| |
|
|
T |
24127880 |
ggtttctcgaggtgccaacctagctgggatgtcgatgatacctcttgatgtctgtcctctcttcttgcttata |
24127808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 34338146 - 34338079
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||| | |||||| ||| |||| ||||||||| ||||| |
|
|
T |
34338146 |
tctcggggtgccaacctagttgggatgtcgatgattcctcttgatggctgtcatctctccttacttat |
34338079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 24617782 - 24617733
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
T |
24617782 |
cggggtgccaacctagttgggatgtcggtgtttcctcttgatgcatgtcc |
24617733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 14641465 - 14641521
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| ||| |||||||||||| |
|
|
T |
14641465 |
cggggtgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctcc |
14641521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 14982413 - 14982480
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||| |||| ||||| ||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
T |
14982413 |
gtttctcgaggtgtcaaccaagttgggatgtcgatgttgcctctt---gtctgtcctctctccttgcttat |
14982480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 16298843 - 16298775
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctct-ccttgcttat |
72 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||| |||| |||||||||| |||||||||| |
|
|
T |
16298843 |
tctcgggatgccaacctagttgggatgtcgatgatgcctcccgatgcctgtcctctctcccttgcttat |
16298775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 24353247 - 24353199
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaat |
49 |
Q |
|
|
|||||||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
T |
24353247 |
ggtttctcggggtgccaatctagttggtatgtcgatgttccctcttaat |
24353199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 9696910 - 9696844
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||| |||||||| ||||||||||||||||| || || | |||| ||||||||||||||||||| |
|
|
T |
9696910 |
tctcggcgtgccaacttagttgggatgtcgatgatgacttctgatgcctgtcctctctccttgctta |
9696844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 43
Target Start/End: Original strand, 26522751 - 26522789
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcct |
43 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
26522751 |
tctcggggtgccaacctagttgggatgtcgatgatgcct |
26522789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 8462033 - 8462074
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |||||||| |
|
|
T |
8462033 |
tctcgaggtgccaacctagttgggatgtcgatgatgcctctt |
8462074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 8483681 - 8483632
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
|||||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
T |
8483681 |
cggggtgccaacctagttgggatgtccgtgtttcctcttgatgcatgtcc |
8483632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 10138897 - 10138938
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||||||||||||||||||||||||||||| | |||||||| |
|
|
T |
10138897 |
tctcggggtgccaacctagttgggatgtcgacgatgcctctt |
10138938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 11319501 - 11319562
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||||| ||||| | || | |||||| |||||||||||||||||| |||||| |
|
|
T |
11319501 |
ggtgccaacctagttgagatgttggtgcttcctcttgatgcatgtcctctctcctagcttat |
11319562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 15141960 - 15141904
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
|||||| |||| |||||||||||||||||||||| |||| |||||| ||||| |||| |
|
|
T |
15141960 |
ggtttcccgggttgccaacctagttgggatgtcggtgtttcctcttgatgcacgtcc |
15141904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 19324769 - 19324801
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
19324769 |
tctcggggtgccaacctagttgggatgtcgatg |
19324801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 22955785 - 22955853
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||| | || ||| | ||||| || | |||||||||||||| |
|
|
T |
22955785 |
tctcggggtgccaacctagttgggatgtcgacgatgtctcctgatgcacatcatttctccttgcttata |
22955853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 23832608 - 23832540
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||| | || ||| | ||||| || | |||||||||||||| |
|
|
T |
23832608 |
tctcggggtgccaacctagttgggatgtcgacgatgtctcctgatgcacatcatttctccttgcttata |
23832540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 27990839 - 27990899
Alignment:
Q |
9 |
ggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgct |
69 |
Q |
|
|
|||||||||| |||| ||||||||||||| || ||||| |||| |||| |||||||||||| |
|
|
T |
27990839 |
ggggtgccaatctagatgggatgtcgatgatgtctcttgatgcctgtcatctctccttgct |
27990899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 24205491 - 24205546
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||| |||||||||||||| | || ||||| |||||||||||||||||| |
|
|
T |
24205491 |
gggtgccaacttagttgggatgtcgttctttcctctcgatgcatgtcctctctcct |
24205546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 65
Target Start/End: Original strand, 30884423 - 30884486
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||| |||||||| ||||||||||||||||||| || | | ||| |||||||||||||||||| |
|
|
T |
30884423 |
gtttatcggggtgtcaacctagttgggatgtcgttgattctccttgatgcatgtcctctctcct |
30884486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 13664206 - 13664148
Alignment:
Q |
15 |
ccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||| ||||||||| || ||||| |||| ||||||| ||||||||||||| |
|
|
T |
13664206 |
ccaacctagttgaaatgtcgatgatgtctcttgatgcctgtcctccctccttgcttata |
13664148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 57
Target Start/End: Complemental strand, 15050082 - 15050036
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
|||||||||||||||||||| ||| |||| |||||| |||||||||| |
|
|
T |
15050082 |
ggtgccaacctagttgggatatcgttgtttcctcttgatgcatgtcc |
15050036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 22705338 - 22705408
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||| ||| |||||||||||||||||||||||| |||| |||||| ||| |||| | |||||| |||||| |
|
|
T |
22705338 |
gtttatcgaggtgccaacctagttgggatgtcggtgttacctcttgatgtgtgtcatttctcctagcttat |
22705408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Complemental strand, 27962095 - 27962065
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
27962095 |
tctcggggtgccaacctagttgggatgtcga |
27962065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 63
Target Start/End: Original strand, 33314328 - 33314386
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctc |
63 |
Q |
|
|
||||||| |||||||||||||| |||||||||| || ||||| ||| ||||||||||| |
|
|
T |
33314328 |
tctcgggatgccaacctagttgagatgtcgatgatgactcttgatgtctgtcctctctc |
33314386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 7242931 - 7242898
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcg |
34 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
7242931 |
ggttcctcggggtgccaacctagttgggatgtcg |
7242898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 73
Target Start/End: Original strand, 9344511 - 9344572
Alignment:
Q |
12 |
gtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||| |||| ||||| ||| ||||| | |||||| ||||||| |
|
|
T |
9344511 |
gtgccaacctagttgggatgtcgttgttttctcttgatgtatgtcatttctcctggcttata |
9344572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 26592564 - 26592508
Alignment:
Q |
15 |
ccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||| ||||| |||| ||||| |||||||| ||||||||||||||| |
|
|
T |
26592564 |
ccaacctagttggaatgtcagtgttctctcttgatgcatgttctctctccttgctta |
26592508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 5e-24; HSPs: 22)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 18517704 - 18517772
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
T |
18517704 |
tctcgggatgccaacctagttgggatgtcgatgttgcctcttgatgcatgtccactctccttgcttata |
18517772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 19826468 - 19826397
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
T |
19826468 |
ggtttcttggggtgccaacctagttgggatgtcgatgttgcctcttaatgcttgtcttccctccttgcttat |
19826397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 26430286 - 26430351
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||||||||| ||||||||||| |||||||| ||| |||||||||||||||| ||||| |
|
|
T |
26430286 |
cggggtgccaacctagttaggatgtcgatgatgcctcttgatgtatgtcctctctccttgtttata |
26430351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 4 - 73
Target Start/End: Original strand, 51661705 - 51661774
Alignment:
Q |
4 |
ttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||| ||||||||| |
|
|
T |
51661705 |
ttctcggggtgccaacctagttgggatgtcgatgttgcctcttgatgtctgtccattctcattgcttata |
51661774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 3736507 - 3736574
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||| ||| ||||| |||||||||||||| |
|
|
T |
3736507 |
tctcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctccttgcttat |
3736574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 1051373 - 1051303
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||| || |||||||||||||||||||||||| |||| |||||| ||| ||||||||||||||||||| |
|
|
T |
1051373 |
ggtttcccgaggtgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctccttgctta |
1051303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 25760053 - 25760106
Alignment:
Q |
12 |
gtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
T |
25760053 |
gtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctcct |
25760106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 5813615 - 5813543
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||| ||||||||||||||| | |||||||||||||||| |||| | |||||||| ||| |||||| |
|
|
T |
5813615 |
ggtttctcgggatgccaacctagttggtaagtcgatgttgcctcttgatgcctatcctctcttcttacttata |
5813543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 16037983 - 16038051
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| |||||||||||| |||||||||| |||||||| ||| |||| |||||||||||||||| |
|
|
T |
16037983 |
tctcggggttccaacctagttgagatgtcgatgatgcctcttgatgtctgtcatctctccttgcttata |
16038051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 16053475 - 16053547
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||| || ||||||||||| |||||||||| |||||||| ||| |||| |||||||||||||||| |
|
|
T |
16053475 |
ggtttctcgggatgtcaacctagttgagatgtcgatgatgcctcttgatgtctgtcatctctccttgcttata |
16053547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 13 - 68
Target Start/End: Complemental strand, 26953995 - 26953940
Alignment:
Q |
13 |
tgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
|||||||||||||||||||||| |||| |||||| ||||||||| ||||||||||| |
|
|
T |
26953995 |
tgccaacctagttgggatgtcggtgtttcctcttgatgcatgtcgtctctccttgc |
26953940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 47165938 - 47165897
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
47165938 |
tctcggggtgccaacctagttgggatgtcgatgatgcctctt |
47165897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 73
Target Start/End: Complemental strand, 2928618 - 2928558
Alignment:
Q |
13 |
tgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||| ||||||||||||| |||| ||| ||||| ||||||||||||||| |
|
|
T |
2928618 |
tgccaacctagttggaatgtcgatgttgcttcttgatgactgtccactctccttgcttata |
2928558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 16041528 - 16041596
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| |||||||||||| |||||||||| |||||||| ||| |||| ||||||| |||||||| |
|
|
T |
16041528 |
tctcggggttccaacctagttgagatgtcgatgatgcctcttgatgtctgtcatctctccatgcttata |
16041596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 59
Target Start/End: Original strand, 19256156 - 19256207
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctc |
59 |
Q |
|
|
|||||||||||||||||| |||||||| |||| |||||| || ||||||||| |
|
|
T |
19256156 |
cggggtgccaacctagttaggatgtcgttgtttcctcttgatacatgtcctc |
19256207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 10623284 - 10623238
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatg |
54 |
Q |
|
|
|||||||||||||||||| |||||||| |||| |||||| ||||||| |
|
|
T |
10623284 |
cggggtgccaacctagttaggatgtcggtgtttcctcttgatgcatg |
10623238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 10997449 - 10997487
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgtt |
39 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
10997449 |
ggtttctcggggtgccaacctaattgggatgtcggtgtt |
10997487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 14674228 - 14674198
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
14674228 |
tcggggtgccaacctagttgggatgtcgatg |
14674198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 65
Target Start/End: Original strand, 19185104 - 19185162
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||||||||||||||||||||| || | | ||| |||| ||||||||||||| |
|
|
T |
19185104 |
tcggggtgccaacctagttgggatgtcgttgcttctccttgatgcctgtcctctctcct |
19185162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 3580479 - 3580438
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||| |||||||||||||||||||| |||||| |||||||| |
|
|
T |
3580479 |
tctcgaggtgccaacctagttgggatttcgatgatgcctctt |
3580438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 65
Target Start/End: Complemental strand, 16309714 - 16309657
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||||| ||||||||||||||| | | |||||| ||| ||||||||||||| |
|
|
T |
16309714 |
cggggtgccaacttagttgggatgtcgaagctacctcttgatgtctgtcctctctcct |
16309657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 65
Target Start/End: Complemental strand, 18490708 - 18490651
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||||| ||||||||||||||| | | |||||| ||| ||||||||||||| |
|
|
T |
18490708 |
cggggtgccaacttagttgggatgtcgaagctacctcttgatgtctgtcctctctcct |
18490651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 25)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36802321 - 36802249
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||| |
|
|
T |
36802321 |
ggtttctcggggtgccaacctagttgagatgtcgatgttgcctcttaatacccgtcctctctccttgcttata |
36802249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 3 - 72
Target Start/End: Original strand, 12102833 - 12102902
Alignment:
Q |
3 |
tttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| | ||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
12102833 |
tttctcgggataccaacatagttgggatgtcgatgttgcctcttgatgtatgtcctctctccttgcttat |
12102902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 20477451 - 20477519
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||| ||| |||||| |||||||||||||| |
|
|
T |
20477451 |
tctcggggtgccaacctagttgggatgtcgatgatgcctcttgatgtctgtcctttctccttgcttata |
20477519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 17377562 - 17377489
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
||||||| |||||||||||||||||| ||| ||| ||||||||||| |||||||||| |||||| ||||||||| |
|
|
T |
17377562 |
ggtttcttggggtgccaacctagttgagatatcgttgttgcctcttgatgcatgtccactctccatgcttatat |
17377489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 29216635 - 29216696
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
29216635 |
ggtgccaacttaattgggatgtcgatgatgcctcttgatgcatgtcctctctccttgcttat |
29216696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 29329934 - 29329995
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
29329934 |
ggtgccaacttaattgggatgtcgatgatgcctcttgatgcatgtcctctctccttgcttat |
29329995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 2 - 74
Target Start/End: Original strand, 28698216 - 28698288
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
|||||||||| |||||||||| |||| ||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
T |
28698216 |
gtttctcgggatgccaacctaattggaatgtcgatgttaccccttaatgtttgtcctctctccttgcttatat |
28698288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 22170018 - 22169951
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||| |||||||||| ||||||||| |||| |||||||| |||| |||||||||||||||||||| |
|
|
T |
22170018 |
tctcgggatgccaacctaattgggatgttgatgatgcctcttgatgcctgtcctctctccttgcttat |
22169951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 40926517 - 40926447
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||| |||| | ||||||||||| |||| |||||| |
|
|
T |
40926517 |
ggtttcccggggtgccaacctagttgggatgtcgatgtttcctcctgatgcatgtccttactccctgctta |
40926447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 5 - 70
Target Start/End: Complemental strand, 17679766 - 17679701
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctt |
70 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||| ||| ||||| |||||||||||| |
|
|
T |
17679766 |
tctcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctccttgctt |
17679701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 34454916 - 34454985
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||| |||| | |||||||||||||| ||||| |
|
|
T |
34454916 |
tctcggggtgccaacctaattgggatgtcgatgatgtctcttgatgcctctcctctctccttgcatatat |
34454985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 38242187 - 38242119
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| | || ||| |||| ||||| ||||| ||||||||| |
|
|
T |
38242187 |
tctcggggtgccaacctagttgggatgtcgatgataccgcttgatgcttgtccactctcattgcttata |
38242119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 20632490 - 20632557
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||| ||| ||||| ||||||||||||| |
|
|
T |
20632490 |
tctcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccattctccttgcttat |
20632557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 24524128 - 24524061
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | || ||| | |||| |||||| ||||||||||||| |
|
|
T |
24524128 |
tctcggggtgccaacctagttgggatgtcgacgatgtctcctgatgcttgtcctttctccttgcttat |
24524061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 2 - 72
Target Start/End: Complemental strand, 40949395 - 40949325
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||||||||| |||||| ||||||||| ||||| |||| |||||| ||||||||||||| |
|
|
T |
40949395 |
gtttctcggggtgccaaccttgttggggtgtcgatgtgttctcttgatgcttgtcctttctccttgcttat |
40949325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 38376916 - 38376856
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
||||| ||||||||||||||| ||||||||||| | |||||| |||||||||| ||||||| |
|
|
T |
38376916 |
tctcgaggtgccaacctagttaggatgtcgatgatacctcttgatgcatgtccactctcct |
38376856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 26916654 - 26916721
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | || ||| | ||| |||||| ||||||||||||| |
|
|
T |
26916654 |
tctcggggtgccaacctagttgggatgtcgacgatgtctcctgatgtttgtcctttctccttgcttat |
26916721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 28522883 - 28522938
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||||||||||||||||| ||||| |||||| ||| ||||||||||||| |
|
|
T |
28522883 |
gggtgccaacctagttgggatgtcaatgtttcctcttgatgtctgtcctctctcct |
28522938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 11 - 73
Target Start/End: Complemental strand, 9892181 - 9892119
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||| |||||||||||||| || ||||| ||| |||| |||||||||||||||| |
|
|
T |
9892181 |
ggtgccaacctaattgggatgtcgatgatgtctcttgatgtctgtcttctctccttgcttata |
9892119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 28462146 - 28462178
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
28462146 |
tctcggggtgccaacctagttgggatgtcgatg |
28462178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 30407063 - 30407130
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| ||| |||||||| ||||||||| || ||| | |||| |||||||||||||||||||| |
|
|
T |
30407063 |
tctcggggtaccactctagttggaatgtcgatgatgtctcatgatgcctgtcctctctccttgcttat |
30407130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Complemental strand, 25971049 - 25971019
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
25971049 |
tctcggggtgccaacctagttgggatgtcga |
25971019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 17678341 - 17678300
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||| |||||||||||| |||||||||||||| |||||||| |
|
|
T |
17678341 |
tctcgaggtgccaacctaattgggatgtcgatgatgcctctt |
17678300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 20386666 - 20386735
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
|||| |||||||||||||||||||||||||| | | ||| | |||| |||| || |||||||||||||| |
|
|
T |
20386666 |
tctcagggtgccaacctagttgggatgtcgacgacgtctcctgatgcctgtcttcactccttgcttatat |
20386735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 20434231 - 20434182
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
||||||||||||||||||| ||||||| |||| | |||||||||||||| |
|
|
T |
20434231 |
cggggtgccaacctagttgtgatgtcgttgtttacccttaatgcatgtcc |
20434182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 21)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 2 - 73
Target Start/End: Complemental strand, 5781135 - 5781064
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
5781135 |
gtttctcgggatgccaacctagttgggatgtcgatgttgcctcttaatgtctgtcctccctccttgcttata |
5781064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 19068750 - 19068677
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
T |
19068750 |
ggtttctcagggtgccaacctagtttggatgtcgatgttgcctcttaatgtctgtcctctctcattgcttatat |
19068677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 4 - 72
Target Start/End: Complemental strand, 6129748 - 6129680
Alignment:
Q |
4 |
ttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||| | | |||||| |||||||||||||||| |
|
|
T |
6129748 |
ttctcggggtgccaacctggttgggatgtcgatgttgcctttggacgcatgttctctctccttgcttat |
6129680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 5784537 - 5784470
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||| ||||||||||||||| ||||||||| |||||||| |||| ||||| |||||||||||||| |
|
|
T |
5784537 |
tctcgggatgccaacctagttggaatgtcgatgatgcctcttgatgcctgtccactctccttgcttat |
5784470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 21711587 - 21711528
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttg |
67 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| |||| ||||||||||||||| |
|
|
T |
21711587 |
cggggtgccaacctagttgggatgtcggtgttccctcttgatgcttgtcctctctccttg |
21711528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 21877953 - 21877886
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||| ||| ||||| |||||||||||||| |
|
|
T |
21877953 |
tctcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctccttgcttat |
21877886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 34995501 - 34995435
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||| | |||| ||||||| ||||||||||| |
|
|
T |
34995501 |
tctcggggtgccaacctagttgggatgtcgatgatgactcctgatgcctgtcctccctccttgctta |
34995435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 35341915 - 35341980
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||| ||||||||||||||||| || ||||| |||| ||||||||||||||||||| |
|
|
T |
35341915 |
tctcggggtgccaac-tagttgggatgtcgatgatgactcttgatgcctgtcctctctccttgctta |
35341980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 15614766 - 15614822
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| |||| |||||||||||| |
|
|
T |
15614766 |
cggggtgccaacctagttgggatgtcggtgttccctcttgatgcttgtcctctctcc |
15614822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 31329329 - 31329261
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||| | |||| |||||||| ||||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
T |
31329329 |
tctcgggataccaatctagttggaatgtcgatgatgcctcttgatgcctgtcctctctccttgcttata |
31329261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 2259453 - 2259390
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
|||||| |||| |||||||||||||||||||||| |||| |||||| |||||||||| |||||| |
|
|
T |
2259453 |
ggtttcccgggatgccaacctagttgggatgtcggtgtttcctcttgatgcatgtccactctcc |
2259390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 12851845 - 12851785
Alignment:
Q |
12 |
gtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||| |||| |||||||| ||| ||||| |||||||||||||| |
|
|
T |
12851845 |
gtgccaacctagttgggatgttgatgatgcctcttgatgtctgtccactctccttgcttat |
12851785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 16574380 - 16574448
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||||| ||||||||||||||||| || ||| | |||| ||||||||||| ||||||||| |
|
|
T |
16574380 |
tctcggggtgccaatttagttgggatgtcgatgatgactcctgatgcctgtcctctctcattgcttata |
16574448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 73
Target Start/End: Complemental strand, 29998615 - 29998556
Alignment:
Q |
13 |
tgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||| || ||||| |||| |||||||||| |||||||||| |
|
|
T |
29998615 |
tgccaacctagttgggatgtcgatgatgtctcttgatgcctgtcctctct-cttgcttata |
29998556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 28682809 - 28682768
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
28682809 |
tctcgggatgccaacctagttgggatgtcgatgatgcctctt |
28682768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 39324398 - 39324357
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |||||||| |
|
|
T |
39324398 |
tctcggagtgccaacctagttgggatgtcgatgatgcctctt |
39324357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 33764540 - 33764508
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
33764540 |
tctcggggtgccaacctagttgggatgtcgatg |
33764508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 13642860 - 13642793
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| |||| |||||||| ||||||||| |||||| | ||| ||||||||||| |||||||| |
|
|
T |
13642860 |
tctcggggtaccaatctagttggaatgtcgatgatgcctcctgatgtctgtcctctctcattgcttat |
13642793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 4120550 - 4120604
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
||||||||||||||||||||||||| |||| |||||| ||| | |||||||||| |
|
|
T |
4120550 |
gggtgccaacctagttgggatgtcggtgttccctcttgatgtttatcctctctcc |
4120604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 28637640 - 28637673
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcg |
34 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
28637640 |
ggttcctcggggtgccaacctagttgggatgtcg |
28637673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 24765557 - 24765501
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
|||||| |||| |||||| ||||||||||||||| | || |||||| |||||||||| |
|
|
T |
24765557 |
ggtttcccgggatgccaatctagttgggatgtcggtatttcctcttgatgcatgtcc |
24765501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0607 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0607
Description:
Target: scaffold0607; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 363 - 291
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||||||||| |||||||| | |||||||||||||||| ||||||||||||||| |||||||||| |
|
|
T |
363 |
ggtttctcggggtgccaaactagttggtaagtcgatgttgcctcttgatgcatgtcctctcttcttgcttata |
291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0292 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0292
Description:
Target: scaffold0292; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 21246 - 21314
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||| |||| ||||| ||||||||||||||| |
|
|
T |
21246 |
tctcggggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtccactctccttgcttata |
21314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 1550 - 1483
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| |
|
|
T |
1550 |
ggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctccttgc |
1483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 26)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 21593209 - 21593276
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |||||||| |||| |||||||||||||||||||| |
|
|
T |
21593209 |
tctcggggtgccaacctagttggaatgtcgatgatgcctcttgatgcctgtcctctctccttgcttat |
21593276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 29840883 - 29840954
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||| |||||||| |
|
|
T |
29840883 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgtttcttgatgcatgtccactctctttgcttat |
29840954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 45268891 - 45268820
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||| ||||| | |||||||||||||||| |||| |||||||||||||||||||| |
|
|
T |
45268891 |
ggtttctcggggtgccaacctggttggtaagtcgatgttgcctcttgatgcctgtcctctctccttgcttat |
45268820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 2 - 72
Target Start/End: Complemental strand, 10568355 - 10568285
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||||||||||||||||||||||| | |||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
10568355 |
gtttctcggggtgccaacctagttggtaagtcgatgttgcctcttgatgtctgtcctctctccttgcttat |
10568285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 6001444 - 6001513
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctt |
70 |
Q |
|
|
||||||||| |||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
6001444 |
ggtttctcgcggtgtcaacctagttggaatgtcgatgttgcctcttaatgtttgtcctctctccttgctt |
6001513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 17959956 - 17959885
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| |||||| |||||||| ||||||||||||||||||||||||| ||||||||||| ||| |||| |
|
|
T |
17959956 |
ggtttctcgtggtgcctacctagttaggatgtcgatgttgcctcttaatgcctgtcctctctctttgtttat |
17959885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 16890000 - 16890066
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||| | |||| ||||||||||||||||||| |
|
|
T |
16890000 |
tctcggggtgccaacctagttgggatgtcgatgatgactcctgatgcctgtcctctctccttgctta |
16890066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 63
Target Start/End: Original strand, 41600747 - 41600808
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctc |
63 |
Q |
|
|
||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||| ||||| |
|
|
T |
41600747 |
gtttctcggggtgccaatctagttgggatatcgatgttgcctcttgatgcatgtccactctc |
41600808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 16290878 - 16290946
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgct |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| ||||||||||| ||| |||||| |||||||||| |
|
|
T |
16290878 |
ggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgtttgtcctttctccttgct |
16290946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 23595403 - 23595467
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgct |
69 |
Q |
|
|
|||| |||| ||||||||||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
T |
23595403 |
tctcagggtaccaacctagttgggatgtcgatgatgcctcttgatgcgtgtcctctctccttgct |
23595467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 23604325 - 23604389
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgct |
69 |
Q |
|
|
|||| |||| ||||||||||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
T |
23604325 |
tctcagggtaccaacctagttgggatgtcgatgatgcctcttgatgcgtgtcctctctccttgct |
23604389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 71
Target Start/End: Original strand, 26657700 - 26657759
Alignment:
Q |
12 |
gtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
|||||||| |||||||||||||| |||| |||||| |||||||||||||||||||||||| |
|
|
T |
26657700 |
gtgccaacttagttgggatgtcggtgtttcctcttgatgcatgtcctctctccttgctta |
26657759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 14413363 - 14413431
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |||| ||| ||| ||||| ||||||||||||||| |
|
|
T |
14413363 |
tctcgaggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctccttgcttata |
14413431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 11 - 73
Target Start/End: Original strand, 17274742 - 17274804
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
T |
17274742 |
ggtgccaaccaagttgggatgtcgatgttgcctcttgatgtctgtccattctccttgcttata |
17274804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 26867480 - 26867541
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctct |
62 |
Q |
|
|
|||||| || ||||||||||||||||||||||||||| |||||||| | || |||||||||| |
|
|
T |
26867480 |
ggtttcccgaggtgccaacctagttgggatgtcgatgatgcctcttgaagcctgtcctctct |
26867541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 11620465 - 11620398
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||| ||||||||||||||| | || ||| | ||||||||||| |||||| |||||| |
|
|
T |
11620465 |
tctcggggtgccaacatagttgggatgtcgacgatgtctcctgatgcatgtcctttctcctagcttat |
11620398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 18036872 - 18036809
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
|||| |||||||||||||| |||||||||||||| |||| |||||| ||| |||||||||||| |
|
|
T |
18036872 |
ggttcctcggggtgccaacatagttgggatgtcggtgtttcctcttgatgtttgtcctctctcc |
18036809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 17802789 - 17802724
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcctt |
66 |
Q |
|
|
||||||||||| |||||||||||||| ||| || |||||||||||| |||| |||| | ||||||| |
|
|
T |
17802789 |
ggtttctcgggatgccaacctagttgagatatcaatgttgcctcttgatgcctgtcatttctcctt |
17802724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 14335333 - 14335401
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| |||| |||||||| |||||||| |||||| | |||| ||||||||||| ||||||||| |
|
|
T |
14335333 |
tctcggggtaccaatctagttggattgtcgatgatgcctcctgatgcctgtcctctctcgttgcttata |
14335401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 24184800 - 24184744
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
|||| |||||||||||||||||||||| |||| |||||| ||| |||||||||||| |
|
|
T |
24184800 |
cgggatgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctcc |
24184744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Original strand, 11837165 - 11837195
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
11837165 |
tctcggggtgccaacctagttgggatgtcga |
11837195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 67
Target Start/End: Original strand, 22998134 - 22998188
Alignment:
Q |
13 |
tgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttg |
67 |
Q |
|
|
||||||||||||||||||||||||| |||||| | |||| | ||| ||||||||| |
|
|
T |
22998134 |
tgccaacctagttgggatgtcgatggtgcctcatgatgcctatccactctccttg |
22998188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Original strand, 23124021 - 23124051
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
23124021 |
tctcggggtgccaacctagttgggatgtcga |
23124051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 12236879 - 12236815
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
||||| |||||||||||||||| ||||||| |||||||| || || ||||||||| | |||||| |
|
|
T |
12236879 |
ggtttatcggggtgccaacctaattgggatatcgatgttttcttttgatgcatgtcatttctcct |
12236815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 19742071 - 19742103
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttg |
40 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |
|
|
T |
19742071 |
cggggtgccaacctagttgggatgtcggtgttg |
19742103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 24317428 - 24317484
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
|||||||||||||||||||| |||| | |||| |||||| ||| |||| |||||||| |
|
|
T |
24317428 |
cggggtgccaacctagttggtatgttggtgtttcctcttgatgtatgttctctctcc |
24317484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36728 - 36656
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| ||| |||||||||||||||||||||||||||||||| ||| |||| ||||||||||| ||||| |
|
|
T |
36728 |
ggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatgtatgtactctctccttgtttata |
36656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 23)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 14073811 - 14073882
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||| |||||||||||||||||| | |||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
14073811 |
ggtttctcagggtgccaacctagttggtaagtcgatgttgcctcttgatgc-tgtcctctctccttgcttata |
14073882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 14383839 - 14383910
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||| |||||||||||||||||| | |||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
14383839 |
ggtttctcagggtgccaacctagttggtaagtcgatgttgcctcttgatgc-tgtcctctctccttgcttata |
14383910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 3 - 63
Target Start/End: Original strand, 28780205 - 28780265
Alignment:
Q |
3 |
tttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctc |
63 |
Q |
|
|
||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
28780205 |
tttcttgggatgccaacctagttgggatgtcgatgttgcctcttgatgcatgtcctctctc |
28780265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 11295426 - 11295350
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctct----taatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||| |||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
T |
11295426 |
ggtttctcggagtgccaacctagtttggatgtcgatgttgcctcttaattaatgcacgtcctctctccttgcttata |
11295350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 3399607 - 3399535
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||| | ||||||||||||| || ||| | ||||||||||||||||||| |
|
|
T |
3399607 |
ggtttctcggggtgccaacctagttggtaagtcgatgttgccttttgatgtctatcctctctccttgcttata |
3399535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 1633326 - 1633393
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
|||||||||||||| |||||||||||| ||||| |||| |||||| ||||||||||||||||||||| |
|
|
T |
1633326 |
ggtttctcggggtgtcaacctagttggattgtcggtgtttcctcttgatgcatgtcctctctccttgc |
1633393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 9062101 - 9062029
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||| ||||||||||| ||||||||||| |||||||||| | ||||||| | || ||||||||| |
|
|
T |
9062101 |
ggtttctcggggtaccaacctagttaggatgtcgatgatgcctcttaaagtatgtcctttgtctttgcttata |
9062029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 61
Target Start/End: Complemental strand, 22849576 - 22849520
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctc |
61 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||| | |||||||||||||| |
|
|
T |
22849576 |
tctcggggtgccaacctagttgggatgtcgatgatgactccttatgcatgtcctctc |
22849520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 73
Target Start/End: Complemental strand, 24573724 - 24573654
Alignment:
Q |
3 |
tttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| | |||||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
T |
24573724 |
tttctcgggctaccaacctagttgggatgtcgatgttgcctcttgatatctgtccattctccttgcttata |
24573654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 9114536 - 9114603
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | ||||||| |||| ||| || |||||||||||| |
|
|
T |
9114536 |
tctcggggtgccaacctagttgggatgtcgacgacgcctcttgatgcctgttttcactccttgcttat |
9114603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 12163417 - 12163467
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgc |
51 |
Q |
|
|
|||||| || |||||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
12163417 |
ggtttcccgaggtgccaacctagttgggatgtcggtgttgcctcttgatgc |
12163467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 12727827 - 12727868
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
12727827 |
tctcgggatgccaacctagttgggatgtcgatgatgcctctt |
12727868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 72
Target Start/End: Complemental strand, 1748351 - 1748292
Alignment:
Q |
13 |
tgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||| ||| |||| || | |||| |||||||||| |||| |
|
|
T |
1748351 |
tgccaacctagttgggatgtcgatgatgcttcttgattcctgtcttctctccttgtttat |
1748292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 9409144 - 9409089
Alignment:
Q |
17 |
aacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||| |||||||||||||||||||| ||| ||||| ||||||||| |||| |
|
|
T |
9409144 |
aacctagttaggatgtcgatgttgcctcttgatgtctgtccactctccttgtttat |
9409089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 3410386 - 3410456
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctct-taatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
||||||| |||||| |||||||||||||||||| || || | |||||| ||| || ||||||||||||||| |
|
|
T |
3410386 |
tctcgggatgccaatctagttgggatgtcgatgatgtctgtataatgcctgttctttctccttgcttatat |
3410456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Complemental strand, 20936864 - 20936834
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
20936864 |
tctcggggtgccaacctagttgggatgtcga |
20936834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 980952 - 981005
Alignment:
Q |
12 |
gtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
||||||||||||||||||||||| | |||||||| ||| ||||||||||||| |
|
|
T |
980952 |
gtgccaacctagttgggatgtcggagctgcctcttgatgtttgtcctctctcct |
981005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 72
Target Start/End: Complemental strand, 2040128 - 2040063
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||| |||||||||||||||||||||| || | |||||| ||| ||||||| |||| | |||||| |
|
|
T |
2040128 |
tcgggatgccaacctagttgggatgtcggtgctacctcttcatgtatgtcctttctcttggcttat |
2040063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 11 - 60
Target Start/End: Complemental strand, 25150940 - 25150891
Alignment:
Q |
11 |
ggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctct |
60 |
Q |
|
|
||||||||| |||||||||| || |||||| |||||||||||||| |||| |
|
|
T |
25150940 |
ggtgccaacttagttgggatatcaatgttgtctcttaatgcatgttctct |
25150891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 37375031 - 37375064
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcg |
34 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
37375031 |
ggttcctcggggtgccaacctagttgggatgtcg |
37375064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 3997209 - 3997173
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctc |
44 |
Q |
|
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
T |
3997209 |
cgggatgccaacctagttgggatgtcggtgttgcctc |
3997173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 18270348 - 18270316
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||| ||||||||||||||||| |
|
|
T |
18270348 |
tctcggggtgccaacttagttgggatgtcgatg |
18270316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 37
Target Start/End: Original strand, 20617894 - 20617922
Alignment:
Q |
9 |
ggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
20617894 |
ggggtgccaacctagttgggatgtcgatg |
20617922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 20)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 33040630 - 33040558
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||| || ||||| | ||||| ||||||||| |
|
|
T |
33040630 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgtctcttgatacatgttcactctctttgcttata |
33040558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 8667153 - 8667083
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||| ||||||||||| |||||||||||||||||||| |||| ||||| |||||||||||||| |
|
|
T |
8667153 |
ggtttctcggggt-ccaacctagttaggatgtcgatgttgcctcttgatgcctgtccactctccttgcttat |
8667083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 39406873 - 39406806
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
||||||||||||||||||||||||||| | |||||||||||||||| |||| | ||||| |||||||| |
|
|
T |
39406873 |
ggtttctcggggtgccaacctagttggtaagtcgatgttgcctcttgatgcctatcctcactccttgc |
39406806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 18234268 - 18234334
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || ||| | |||| ||||||||||||||||||| |
|
|
T |
18234268 |
tctcggggtgccaacctagttggaatgtcgatgatgactcctcatgcctgtcctctctccttgctta |
18234334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 34512089 - 34512146
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||| |||| ||||| ||||||| |
|
|
T |
34512089 |
cggggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtccactctcct |
34512146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 44673724 - 44673660
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||| | ||| ||||||||||||| |
|
|
T |
44673724 |
cggggtgccaacctagttgggatgtcgatgttgcctcttgatgtctatccattctccttgcttat |
44673660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 65
Target Start/End: Complemental strand, 37005950 - 37005893
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcct |
65 |
Q |
|
|
||||||||||||||| ||||||||||| || | |||||| |||||||||||||||||| |
|
|
T |
37005950 |
cggggtgccaacctaattgggatgtcggtgcttcctcttgatgcatgtcctctctcct |
37005893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 11485249 - 11485197
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
||||||||||||||||||||||||||||||| | | |||||| |||||||||| |
|
|
T |
11485249 |
tctcggggtgccaacctagttgggatgtcgaagatacctcttgatgcatgtcc |
11485197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 20380266 - 20380198
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||| |||||||||||||||| ||||| |||||||| ||| ||| ||||||||||||||||| |
|
|
T |
20380266 |
tctcggggtttcaacctagttgggatgccgatgatgcctcttgatgtctgttctctctccttgcttata |
20380198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 55
Target Start/End: Complemental strand, 34657962 - 34657915
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgt |
55 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| |||||||| |
|
|
T |
34657962 |
cggggtgccaacctagttgggatgtcggtgtttcctcttgatgcatgt |
34657915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 4936047 - 4936092
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
|||||| |||||||||||| ||||||||||||||||||| |||||| |
|
|
T |
4936047 |
ggtttcgcggggtgccaacttagttgggatgtcgatgtttcctctt |
4936092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 7190100 - 7190141
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |||||||| |
|
|
T |
7190100 |
tctcgaggtgccaacctagttgggatgtcgatgatgcctctt |
7190141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 1924706 - 1924674
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
1924706 |
tctcggggtgccaacctagttgggatgtcgatg |
1924674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 19904661 - 19904597
Alignment:
Q |
9 |
ggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||| || ||||| |||| ||| ||||||||| ||||| |
|
|
T |
19904661 |
ggggtgccaacctagttgggatgtcgatgatgtctcttgatgcccttccactctccttgtttata |
19904597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 44453129 - 44453093
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctc |
44 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| |
|
|
T |
44453129 |
cggggtgccaacctagttgggatgtcgatgtggcctc |
44453093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 17941048 - 17941111
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||| |||| |||||||| ||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
T |
17941048 |
gggtaccaatctagttggaatgtcgatgatgcctcccgatgcctgtcctctctccttgcttata |
17941111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 73
Target Start/End: Complemental strand, 21424840 - 21424777
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||| ||||| |||||||||| |||||| |||||| | |||| | ||||||||||||||||||| |
|
|
T |
21424840 |
gggtaccaacttagttgggatatcgatgatgcctcctgatgcctatcctctctccttgcttata |
21424777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 11416022 - 11415964
Alignment:
Q |
10 |
gggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgc |
68 |
Q |
|
|
|||||||||| |||||||||||||| |||| ||| || ||| |||||||||||||||| |
|
|
T |
11416022 |
gggtgccaacttagttgggatgtcggtgtttccttttgatgtttgtcctctctccttgc |
11415964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 18025454 - 18025424
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
18025454 |
tcggggtgccaacctagttgggatgtcgatg |
18025424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 6192611 - 6192643
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |
|
|
T |
6192611 |
tctcgaggtgccaacctagttgggatgtcgatg |
6192643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0437
Description:
Target: scaffold0437; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 14382 - 14315
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
T |
14382 |
tctcgggatgccaacctagttgggatgtcgatgatgcctcttgatgtctgtcctctctccttgcttat |
14315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 11443 - 11499
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctcc |
64 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| ||| |||||||||||| |
|
|
T |
11443 |
cggggtgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctcc |
11499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 3 - 74
Target Start/End: Original strand, 103730 - 103801
Alignment:
Q |
3 |
tttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttatat |
74 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
T |
103730 |
tttctcggggtgccaacctagttgggatgtcgatgttgcctcttgatgtcggtccattctccttgcttatat |
103801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 72
Target Start/End: Complemental strand, 55826 - 55761
Alignment:
Q |
7 |
tcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| |||| ||| ||| ||||| |||||||||||||| |
|
|
T |
55826 |
tcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtctgtccactctccttgcttat |
55761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0134 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0134
Description:
Target: scaffold0134; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 2507 - 2574
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | || ||| | ||||||||||| ||||||||||||| |
|
|
T |
2507 |
tctcggggtgccaacctagttgggatgtcgacgatgtctcctgatgcatgtcctttctccttgcttat |
2574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 2323 - 2382
Alignment:
Q |
8 |
cggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttg |
67 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||| |||| ||||||||||||||| |
|
|
T |
2323 |
cggggtgccaacctagttgggatgtcggtgttccctcttgatgcttgtcctctctccttg |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0886 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0886
Description:
Target: scaffold0886; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 2804 - 2865
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctct |
62 |
Q |
|
|
||||||||| ||| |||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
T |
2804 |
ggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatgtatgttctctct |
2865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0363 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0363
Description:
Target: scaffold0363; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 5348 - 5280
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |||| ||| ||| ||||| ||||||||||||||| |
|
|
T |
5348 |
tctcgaggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctccttgcttata |
5280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 173894 - 173962
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||| | ||| ||||||||| ||||||||||| |
|
|
T |
173894 |
tctcggggtgccaacctagttgggatgtcgatgatgtctcctgatgtctgtcctctcgccttgcttata |
173962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1821 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold1821
Description:
Target: scaffold1821; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 1006 - 1073
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | || ||| | ||||| ||||| ||||||||||||| |
|
|
T |
1006 |
tctcggggtgccaacctagttgggatgtcgacgatgtctcctgatgcacgtcctttctccttgcttat |
1073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0093 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0093
Description:
Target: scaffold0093; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 16050 - 16117
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |||| ||| ||| ||||| |||||||||||||| |
|
|
T |
16050 |
tctcggagtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctccttgcttat |
16117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 786 - 856
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||| |||||||||||||||||||||||||||| ||||||||||| ||| |||| | |||| ||||||| |
|
|
T |
786 |
ggtttttcggggtgccaacctagttgggatgtcggtgttgcctcttgatgtctgtcatttctcgttgctta |
856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0314 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0314
Description:
Target: scaffold0314; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 582 - 635
Alignment:
Q |
20 |
ctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
|||||||| ||||||||| |||||||| ||||||||||||||||||| |||||| |
|
|
T |
582 |
ctagttggaatgtcgatgatgcctcttgatgcatgtcctctctccttacttata |
635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0216 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0216
Description:
Target: scaffold0216; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 73
Target Start/End: Complemental strand, 15129 - 15069
Alignment:
Q |
13 |
tgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||| || ||||||| |||| ||||||||||||||||||||| |
|
|
T |
15129 |
tgccaacctagttgggatgtcattgatgcctctgaatgtctgtcctctctccttgcttata |
15069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 129447 - 129515
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||| ||| | ||| |||||| |||||||| |
|
|
T |
129447 |
tctcggggtgccaacctagttgggatgtcgatgatgactcttgatgtttttccactctccgtgcttata |
129515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 307264 - 307332
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttata |
73 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||| ||| | ||| |||||| |||||||| |
|
|
T |
307264 |
tctcggggtgccaacctagttgggatgtcgatgatgactcttgatgtttttccactctccgtgcttata |
307332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0546 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0546
Description:
Target: scaffold0546; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 5923 - 5856
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | ||||||| |||||||| || ||||| |||||| |
|
|
T |
5923 |
tctcggggtgccaacctagttgggatgtcgacgacgcctcttgatgcatgttttcactcctagcttat |
5856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0109 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0109
Description:
Target: scaffold0109; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 7384 - 7451
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgcttat |
72 |
Q |
|
|
||||||||||||||||||||||||||||||| | ||||||| |||||||| || ||||| |||||| |
|
|
T |
7384 |
tctcggggtgccaacctagttgggatgtcgacgacgcctcttgatgcatgttttcactcctagcttat |
7451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0265 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0265
Description:
Target: scaffold0265; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 19620 - 19554
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcctctctccttgctta |
71 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||| ||| | ||| | ||||||||||| |
|
|
T |
19620 |
tctcggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttttccacactccttgctta |
19554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 21926 - 21885
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
21926 |
tctcgggatgccaacctagttgggatgtcgatgatgcctctt |
21885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 123897 - 123856
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatgttgcctctt |
46 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||| |
|
|
T |
123897 |
tctcggggtgccaacctagttgggatgtcgatgatgtctctt |
123856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0125
Description:
Target: scaffold0125; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 35562 - 35530
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
35562 |
tctcggggtgccaacctagttgggatgtcgatg |
35530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 20724 - 20692
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
20724 |
tctcggggtgccaacctagttgggatgtcgatg |
20692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0553 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0553
Description:
Target: scaffold0553; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 7551 - 7519
Alignment:
Q |
5 |
tctcggggtgccaacctagttgggatgtcgatg |
37 |
Q |
|
|
|||||||||||||||||||||||||||| |||| |
|
|
T |
7551 |
tctcggggtgccaacctagttgggatgtagatg |
7519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0356 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0356
Description:
Target: scaffold0356; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 34
Target Start/End: Original strand, 13748 - 13780
Alignment:
Q |
2 |
gtttctcggggtgccaacctagttgggatgtcg |
34 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |
|
|
T |
13748 |
gtttcccggggtgccaacctagttgggatgtcg |
13780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8054 - 7998
Alignment:
Q |
1 |
ggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttaatgcatgtcc |
57 |
Q |
|
|
|||||| |||| |||||| ||||||||||||||| | || |||||| |||||||||| |
|
|
T |
8054 |
ggtttcccgggatgccaatctagttgggatgtcggtatttcctcttgatgcatgtcc |
7998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University