View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0668_low_9 (Length: 359)
Name: NF0668_low_9
Description: NF0668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0668_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 104 - 284
Target Start/End: Original strand, 27715680 - 27715860
Alignment:
Q |
104 |
gtaacgggcctgtcagtagcagcatgagttgagaatatgtcatgttgatcaaattttggctttgaaatttgttccttatcttctcccctacattaactgt |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27715680 |
gtaacgggcctgtcagtagcagcatgagttgagaatatgtcatgttgatcaaattttggctttgaaatttgttccttatcttctcccctacattaactgt |
27715779 |
T |
 |
Q |
204 |
ttctcatatgtgccatttattggatgaaggctcctcaatactggcttatacaattgtctgatagtctcttttaattttgtt |
284 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
27715780 |
ttctcctatgtgccatttattggatgaaggctcctcaatactggcttatacaattgtctgatggtctcttttaattttgtt |
27715860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University