View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_high_19 (Length: 328)
Name: NF0669_high_19
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 30 - 287
Target Start/End: Original strand, 3641172 - 3641429
Alignment:
Q |
30 |
gttgtggttttggattgtgttggttttgatgattctgtccccaaaatagcagtgaaatcgttgtttaagccattggaaagaatccaagattactcgaaga |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3641172 |
gttgtggttttggattgtgttggttttgatgattctgtctccaaaatagcagtgaaatcgttgtttaagccattggaaagaatccaagattactcgaaga |
3641271 |
T |
 |
Q |
130 |
aatgtatgaaattggaaagattgtcttgtggcaagcaaggttgatctacttacatcccaggtttcacttacaaagttagatagagggattccacaagatg |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3641272 |
aatgtatgaaattggaaagattgtcttgtggcaagcaaggttgatctacttacatcccaggtttcacttacaaagttagatagagggattccacaagatg |
3641371 |
T |
 |
Q |
230 |
caagtgctggatgaacgccctagttaagcgcaatttttctattctttgttttacacct |
287 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3641372 |
caagtgctggatgaacgccctagttaagcgcaatttttctattctttgttttacacct |
3641429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 34 - 107
Target Start/End: Complemental strand, 35677716 - 35677643
Alignment:
Q |
34 |
tggttttggattgtgttggttttgatgattctgtccccaaaatagcagtgaaatcgttgtttaagccattggaa |
107 |
Q |
|
|
||||| |||||||||||| |||||||| |||| |||| | || ||| ||||| |||||||||||| |||||||| |
|
|
T |
35677716 |
tggttgtggattgtgttgattttgatggttctttcccgagaacagctgtgaagtcgttgtttaaggcattggaa |
35677643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University